ID: 971361633

View in Genome Browser
Species Human (GRCh38)
Location 4:25943380-25943402
Sequence GGCCAATGGGCTGGGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971361627_971361633 -6 Left 971361627 4:25943363-25943385 CCAAGGGGCTTGGCCAAGGCCAA No data
Right 971361633 4:25943380-25943402 GGCCAATGGGCTGGGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971361633 Original CRISPR GGCCAATGGGCTGGGAGTGA AGG Intergenic
No off target data available for this crispr