ID: 971362500

View in Genome Browser
Species Human (GRCh38)
Location 4:25950890-25950912
Sequence CCACTTTCATGGTGTTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971362500_971362509 15 Left 971362500 4:25950890-25950912 CCAGGGCAACACCATGAAAGTGG No data
Right 971362509 4:25950928-25950950 CCACGTCACCTGGGAAGGGAAGG No data
971362500_971362505 6 Left 971362500 4:25950890-25950912 CCAGGGCAACACCATGAAAGTGG No data
Right 971362505 4:25950919-25950941 TTCTCTGAGCCACGTCACCTGGG No data
971362500_971362506 10 Left 971362500 4:25950890-25950912 CCAGGGCAACACCATGAAAGTGG No data
Right 971362506 4:25950923-25950945 CTGAGCCACGTCACCTGGGAAGG No data
971362500_971362507 11 Left 971362500 4:25950890-25950912 CCAGGGCAACACCATGAAAGTGG No data
Right 971362507 4:25950924-25950946 TGAGCCACGTCACCTGGGAAGGG No data
971362500_971362504 5 Left 971362500 4:25950890-25950912 CCAGGGCAACACCATGAAAGTGG No data
Right 971362504 4:25950918-25950940 ATTCTCTGAGCCACGTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971362500 Original CRISPR CCACTTTCATGGTGTTGCCC TGG (reversed) Intergenic
No off target data available for this crispr