ID: 971368184

View in Genome Browser
Species Human (GRCh38)
Location 4:25994209-25994231
Sequence CCTCCAACTCCACAACTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971368177_971368184 15 Left 971368177 4:25994171-25994193 CCCATGCTGTCAGAGTTCAGCTG No data
Right 971368184 4:25994209-25994231 CCTCCAACTCCACAACTGATAGG No data
971368178_971368184 14 Left 971368178 4:25994172-25994194 CCATGCTGTCAGAGTTCAGCTGT No data
Right 971368184 4:25994209-25994231 CCTCCAACTCCACAACTGATAGG No data
971368176_971368184 24 Left 971368176 4:25994162-25994184 CCAGAGCTTCCCATGCTGTCAGA No data
Right 971368184 4:25994209-25994231 CCTCCAACTCCACAACTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971368184 Original CRISPR CCTCCAACTCCACAACTGAT AGG Intergenic