ID: 971368985

View in Genome Browser
Species Human (GRCh38)
Location 4:26000474-26000496
Sequence GGTTCTGTGCCAGGACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971368985_971368991 1 Left 971368985 4:26000474-26000496 CCTGCTTGTCCTGGCACAGAACC No data
Right 971368991 4:26000498-26000520 CTTGCAGCAGGACACACTGTTGG No data
971368985_971368992 11 Left 971368985 4:26000474-26000496 CCTGCTTGTCCTGGCACAGAACC No data
Right 971368992 4:26000508-26000530 GACACACTGTTGGCCAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971368985 Original CRISPR GGTTCTGTGCCAGGACAAGC AGG (reversed) Intergenic
No off target data available for this crispr