ID: 971372294

View in Genome Browser
Species Human (GRCh38)
Location 4:26028859-26028881
Sequence CGGCCTTGCCTGTAACCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971372294_971372299 2 Left 971372294 4:26028859-26028881 CCTGAGGGTTACAGGCAAGGCCG No data
Right 971372299 4:26028884-26028906 CCAGGCACGCAGCACCTGCCGGG No data
971372294_971372302 16 Left 971372294 4:26028859-26028881 CCTGAGGGTTACAGGCAAGGCCG No data
Right 971372302 4:26028898-26028920 CCTGCCGGGCGCCACCCAGGAGG No data
971372294_971372304 18 Left 971372294 4:26028859-26028881 CCTGAGGGTTACAGGCAAGGCCG No data
Right 971372304 4:26028900-26028922 TGCCGGGCGCCACCCAGGAGGGG No data
971372294_971372297 1 Left 971372294 4:26028859-26028881 CCTGAGGGTTACAGGCAAGGCCG No data
Right 971372297 4:26028883-26028905 TCCAGGCACGCAGCACCTGCCGG No data
971372294_971372303 17 Left 971372294 4:26028859-26028881 CCTGAGGGTTACAGGCAAGGCCG No data
Right 971372303 4:26028899-26028921 CTGCCGGGCGCCACCCAGGAGGG No data
971372294_971372300 13 Left 971372294 4:26028859-26028881 CCTGAGGGTTACAGGCAAGGCCG No data
Right 971372300 4:26028895-26028917 GCACCTGCCGGGCGCCACCCAGG No data
971372294_971372305 19 Left 971372294 4:26028859-26028881 CCTGAGGGTTACAGGCAAGGCCG No data
Right 971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971372294 Original CRISPR CGGCCTTGCCTGTAACCCTC AGG (reversed) Intergenic
No off target data available for this crispr