ID: 971372296

View in Genome Browser
Species Human (GRCh38)
Location 4:26028879-26028901
Sequence CAGGTGCTGCGTGCCTGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971372296_971372300 -7 Left 971372296 4:26028879-26028901 CCGCTCCAGGCACGCAGCACCTG No data
Right 971372300 4:26028895-26028917 GCACCTGCCGGGCGCCACCCAGG No data
971372296_971372304 -2 Left 971372296 4:26028879-26028901 CCGCTCCAGGCACGCAGCACCTG No data
Right 971372304 4:26028900-26028922 TGCCGGGCGCCACCCAGGAGGGG No data
971372296_971372305 -1 Left 971372296 4:26028879-26028901 CCGCTCCAGGCACGCAGCACCTG No data
Right 971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG No data
971372296_971372303 -3 Left 971372296 4:26028879-26028901 CCGCTCCAGGCACGCAGCACCTG No data
Right 971372303 4:26028899-26028921 CTGCCGGGCGCCACCCAGGAGGG No data
971372296_971372302 -4 Left 971372296 4:26028879-26028901 CCGCTCCAGGCACGCAGCACCTG No data
Right 971372302 4:26028898-26028920 CCTGCCGGGCGCCACCCAGGAGG No data
971372296_971372310 23 Left 971372296 4:26028879-26028901 CCGCTCCAGGCACGCAGCACCTG No data
Right 971372310 4:26028925-26028947 AGCAGCGCCATTCGCAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971372296 Original CRISPR CAGGTGCTGCGTGCCTGGAG CGG (reversed) Intergenic
No off target data available for this crispr