ID: 971372298

View in Genome Browser
Species Human (GRCh38)
Location 4:26028884-26028906
Sequence CCCGGCAGGTGCTGCGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971372298_971372302 -9 Left 971372298 4:26028884-26028906 CCAGGCACGCAGCACCTGCCGGG No data
Right 971372302 4:26028898-26028920 CCTGCCGGGCGCCACCCAGGAGG No data
971372298_971372305 -6 Left 971372298 4:26028884-26028906 CCAGGCACGCAGCACCTGCCGGG No data
Right 971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG No data
971372298_971372304 -7 Left 971372298 4:26028884-26028906 CCAGGCACGCAGCACCTGCCGGG No data
Right 971372304 4:26028900-26028922 TGCCGGGCGCCACCCAGGAGGGG No data
971372298_971372310 18 Left 971372298 4:26028884-26028906 CCAGGCACGCAGCACCTGCCGGG No data
Right 971372310 4:26028925-26028947 AGCAGCGCCATTCGCAAAGCCGG No data
971372298_971372303 -8 Left 971372298 4:26028884-26028906 CCAGGCACGCAGCACCTGCCGGG No data
Right 971372303 4:26028899-26028921 CTGCCGGGCGCCACCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971372298 Original CRISPR CCCGGCAGGTGCTGCGTGCC TGG (reversed) Intergenic
No off target data available for this crispr