ID: 971372305

View in Genome Browser
Species Human (GRCh38)
Location 4:26028901-26028923
Sequence GCCGGGCGCCACCCAGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971372293_971372305 20 Left 971372293 4:26028858-26028880 CCCTGAGGGTTACAGGCAAGGCC No data
Right 971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG No data
971372298_971372305 -6 Left 971372298 4:26028884-26028906 CCAGGCACGCAGCACCTGCCGGG No data
Right 971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG No data
971372296_971372305 -1 Left 971372296 4:26028879-26028901 CCGCTCCAGGCACGCAGCACCTG No data
Right 971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG No data
971372294_971372305 19 Left 971372294 4:26028859-26028881 CCTGAGGGTTACAGGCAAGGCCG No data
Right 971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971372305 Original CRISPR GCCGGGCGCCACCCAGGAGG GGG Intergenic
No off target data available for this crispr