ID: 971381416

View in Genome Browser
Species Human (GRCh38)
Location 4:26101889-26101911
Sequence CAATATACGAAGCACCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971381413_971381416 0 Left 971381413 4:26101866-26101888 CCATTAAGAGTACACTTTATGGC No data
Right 971381416 4:26101889-26101911 CAATATACGAAGCACCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971381416 Original CRISPR CAATATACGAAGCACCTACA GGG Intergenic
No off target data available for this crispr