ID: 971386609

View in Genome Browser
Species Human (GRCh38)
Location 4:26146269-26146291
Sequence AAGTGCCAACATAATTTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971386607_971386609 1 Left 971386607 4:26146245-26146267 CCTTGGTCAACTGATTTTCAACA No data
Right 971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG No data
971386604_971386609 14 Left 971386604 4:26146232-26146254 CCAGTGCACCCAGCCTTGGTCAA No data
Right 971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG No data
971386605_971386609 6 Left 971386605 4:26146240-26146262 CCCAGCCTTGGTCAACTGATTTT No data
Right 971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG No data
971386606_971386609 5 Left 971386606 4:26146241-26146263 CCAGCCTTGGTCAACTGATTTTC No data
Right 971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971386609 Original CRISPR AAGTGCCAACATAATTTACT GGG Intergenic
No off target data available for this crispr