ID: 971387452

View in Genome Browser
Species Human (GRCh38)
Location 4:26154319-26154341
Sequence TTACCTCACTGGGTAATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971387447_971387452 12 Left 971387447 4:26154284-26154306 CCATCTGTAAAACAGGATAAATA No data
Right 971387452 4:26154319-26154341 TTACCTCACTGGGTAATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971387452 Original CRISPR TTACCTCACTGGGTAATTCA GGG Intergenic