ID: 971393065

View in Genome Browser
Species Human (GRCh38)
Location 4:26203938-26203960
Sequence GATCATCTGGCTTCATTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971393065_971393071 6 Left 971393065 4:26203938-26203960 CCTTAAAATGAAGCCAGATGATC 0: 1
1: 0
2: 1
3: 20
4: 204
Right 971393071 4:26203967-26203989 CCAGGGTCTCACTCTCCCACGGG 0: 1
1: 0
2: 6
3: 207
4: 1317
971393065_971393073 11 Left 971393065 4:26203938-26203960 CCTTAAAATGAAGCCAGATGATC 0: 1
1: 0
2: 1
3: 20
4: 204
Right 971393073 4:26203972-26203994 GTCTCACTCTCCCACGGGGCTGG 0: 1
1: 0
2: 4
3: 171
4: 4099
971393065_971393072 7 Left 971393065 4:26203938-26203960 CCTTAAAATGAAGCCAGATGATC 0: 1
1: 0
2: 1
3: 20
4: 204
Right 971393072 4:26203968-26203990 CAGGGTCTCACTCTCCCACGGGG No data
971393065_971393069 5 Left 971393065 4:26203938-26203960 CCTTAAAATGAAGCCAGATGATC 0: 1
1: 0
2: 1
3: 20
4: 204
Right 971393069 4:26203966-26203988 ACCAGGGTCTCACTCTCCCACGG 0: 1
1: 0
2: 2
3: 25
4: 203
971393065_971393075 21 Left 971393065 4:26203938-26203960 CCTTAAAATGAAGCCAGATGATC 0: 1
1: 0
2: 1
3: 20
4: 204
Right 971393075 4:26203982-26204004 CCCACGGGGCTGGAGTGTAGTGG 0: 1
1: 0
2: 5
3: 163
4: 2485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971393065 Original CRISPR GATCATCTGGCTTCATTTTA AGG (reversed) Intronic