ID: 971393068

View in Genome Browser
Species Human (GRCh38)
Location 4:26203951-26203973
Sequence ACCCTGGTCACTTGATCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971393068_971393072 -6 Left 971393068 4:26203951-26203973 CCAGATGATCAAGTGACCAGGGT 0: 1
1: 0
2: 2
3: 8
4: 62
Right 971393072 4:26203968-26203990 CAGGGTCTCACTCTCCCACGGGG No data
971393068_971393073 -2 Left 971393068 4:26203951-26203973 CCAGATGATCAAGTGACCAGGGT 0: 1
1: 0
2: 2
3: 8
4: 62
Right 971393073 4:26203972-26203994 GTCTCACTCTCCCACGGGGCTGG 0: 1
1: 0
2: 4
3: 171
4: 4099
971393068_971393071 -7 Left 971393068 4:26203951-26203973 CCAGATGATCAAGTGACCAGGGT 0: 1
1: 0
2: 2
3: 8
4: 62
Right 971393071 4:26203967-26203989 CCAGGGTCTCACTCTCCCACGGG 0: 1
1: 0
2: 6
3: 207
4: 1317
971393068_971393069 -8 Left 971393068 4:26203951-26203973 CCAGATGATCAAGTGACCAGGGT 0: 1
1: 0
2: 2
3: 8
4: 62
Right 971393069 4:26203966-26203988 ACCAGGGTCTCACTCTCCCACGG 0: 1
1: 0
2: 2
3: 25
4: 203
971393068_971393075 8 Left 971393068 4:26203951-26203973 CCAGATGATCAAGTGACCAGGGT 0: 1
1: 0
2: 2
3: 8
4: 62
Right 971393075 4:26203982-26204004 CCCACGGGGCTGGAGTGTAGTGG 0: 1
1: 0
2: 5
3: 163
4: 2485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971393068 Original CRISPR ACCCTGGTCACTTGATCATC TGG (reversed) Intronic