ID: 971393073 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:26203972-26203994 |
Sequence | GTCTCACTCTCCCACGGGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 4275 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 171, 4: 4099} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
971393065_971393073 | 11 | Left | 971393065 | 4:26203938-26203960 | CCTTAAAATGAAGCCAGATGATC | 0: 1 1: 0 2: 1 3: 20 4: 204 |
||
Right | 971393073 | 4:26203972-26203994 | GTCTCACTCTCCCACGGGGCTGG | 0: 1 1: 0 2: 4 3: 171 4: 4099 |
||||
971393068_971393073 | -2 | Left | 971393068 | 4:26203951-26203973 | CCAGATGATCAAGTGACCAGGGT | 0: 1 1: 0 2: 2 3: 8 4: 62 |
||
Right | 971393073 | 4:26203972-26203994 | GTCTCACTCTCCCACGGGGCTGG | 0: 1 1: 0 2: 4 3: 171 4: 4099 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
971393073 | Original CRISPR | GTCTCACTCTCCCACGGGGC TGG | Intronic | ||