ID: 971393073

View in Genome Browser
Species Human (GRCh38)
Location 4:26203972-26203994
Sequence GTCTCACTCTCCCACGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4275
Summary {0: 1, 1: 0, 2: 4, 3: 171, 4: 4099}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971393068_971393073 -2 Left 971393068 4:26203951-26203973 CCAGATGATCAAGTGACCAGGGT 0: 1
1: 0
2: 2
3: 8
4: 62
Right 971393073 4:26203972-26203994 GTCTCACTCTCCCACGGGGCTGG 0: 1
1: 0
2: 4
3: 171
4: 4099
971393065_971393073 11 Left 971393065 4:26203938-26203960 CCTTAAAATGAAGCCAGATGATC 0: 1
1: 0
2: 1
3: 20
4: 204
Right 971393073 4:26203972-26203994 GTCTCACTCTCCCACGGGGCTGG 0: 1
1: 0
2: 4
3: 171
4: 4099

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971393073 Original CRISPR GTCTCACTCTCCCACGGGGC TGG Intronic
Too many off-targets to display for this crispr