ID: 971393548

View in Genome Browser
Species Human (GRCh38)
Location 4:26207855-26207877
Sequence CTCGGTTCCTGGCCTCCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971393548_971393551 7 Left 971393548 4:26207855-26207877 CCGTCAGGAGGCCAGGAACCGAG 0: 1
1: 0
2: 0
3: 25
4: 185
Right 971393551 4:26207885-26207907 TTTTGAGCAGAGACTTGTTGTGG 0: 1
1: 0
2: 2
3: 24
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971393548 Original CRISPR CTCGGTTCCTGGCCTCCTGA CGG (reversed) Intronic