ID: 971394720

View in Genome Browser
Species Human (GRCh38)
Location 4:26217352-26217374
Sequence CATTCAGCTGTGTGCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 308}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971394713_971394720 1 Left 971394713 4:26217328-26217350 CCCTGAAAATGCCCCTTCCTTTT 0: 1
1: 0
2: 2
3: 45
4: 471
Right 971394720 4:26217352-26217374 CATTCAGCTGTGTGCTCCTGTGG 0: 1
1: 0
2: 4
3: 21
4: 308
971394714_971394720 0 Left 971394714 4:26217329-26217351 CCTGAAAATGCCCCTTCCTTTTC 0: 1
1: 0
2: 9
3: 57
4: 559
Right 971394720 4:26217352-26217374 CATTCAGCTGTGTGCTCCTGTGG 0: 1
1: 0
2: 4
3: 21
4: 308
971394715_971394720 -10 Left 971394715 4:26217339-26217361 CCCCTTCCTTTTCCATTCAGCTG 0: 1
1: 0
2: 2
3: 53
4: 479
Right 971394720 4:26217352-26217374 CATTCAGCTGTGTGCTCCTGTGG 0: 1
1: 0
2: 4
3: 21
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971394720 Original CRISPR CATTCAGCTGTGTGCTCCTG TGG Intronic
900848814 1:5125831-5125853 AATTCAGCTCTGTGCTGTTGTGG + Intergenic
900990796 1:6097290-6097312 GAGTCAGCTCCGTGCTCCTGGGG + Exonic
901113261 1:6816645-6816667 CATTCCACTGTGTTGTCCTGTGG + Intronic
901203349 1:7479301-7479323 TGTACAGCTGTGTGCACCTGTGG - Intronic
901957114 1:12794400-12794422 AATTCAGCTCTGTGTTCCTCAGG + Exonic
901980517 1:13030532-13030554 AATTCAGCTCTGTGTTCCTCGGG + Intronic
902001571 1:13198399-13198421 AATTCAGCTCTGTGTTCCTCGGG - Intergenic
902004968 1:13224926-13224948 AATTCAGCTCTGTGCTCCTCAGG - Intergenic
902020804 1:13344109-13344131 AATTCAGCTCTGTGTTCCTCAGG - Exonic
902024187 1:13370720-13370742 AATTCAGCTCTGTGTTCCTCAGG - Exonic
902926746 1:19700838-19700860 CATCCTGCTGGGTGCGCCTGTGG - Exonic
904425102 1:30417871-30417893 CAGCCAGCTTTGTGCTGCTGAGG + Intergenic
905010703 1:34745241-34745263 CATTTACCTGTGTTCTGCTGAGG + Intronic
905653296 1:39670912-39670934 CATTGTGCAGTGAGCTCCTGAGG + Intronic
906149530 1:43579464-43579486 TGTTCAGCTGTGAGCCCCTGTGG + Intronic
906274581 1:44506528-44506550 CCTTCATCTGTTTGCCCCTGGGG + Intronic
906490661 1:46266033-46266055 CTCTCAACTCTGTGCTCCTGTGG - Intronic
907248694 1:53123641-53123663 CATCCAGCTGTGCCCTCCTCTGG - Intronic
907978852 1:59460669-59460691 CATACAGCTGGGTGCCCCTCTGG + Intronic
910202874 1:84717895-84717917 CATTCAACTCTCTGCTTCTGTGG - Intergenic
910664446 1:89709428-89709450 CACTCAGCTGTGTGCACTTGGGG - Intronic
910682543 1:89882252-89882274 TATTCACCTTTGTGTTCCTGGGG - Intronic
911221292 1:95250214-95250236 TAGTCAGCTCTGTTCTCCTGAGG - Intergenic
911695514 1:100886726-100886748 AATCCAGCTATCTGCTCCTGAGG + Intronic
912072387 1:105827770-105827792 CATTCTGCTCTCTGCTTCTGGGG - Intergenic
915006338 1:152640608-152640630 CCTTCAGCTGTGGCCTCCTGTGG + Intergenic
917107635 1:171509345-171509367 CCTTCAGCTCAGTACTCCTGAGG - Intronic
917432303 1:174983203-174983225 CAGTCAGATGTGGGCTGCTGAGG - Intronic
918461147 1:184778042-184778064 CTTTCAGCTGTGTATTACTGAGG - Intergenic
918625416 1:186651514-186651536 CACTCTGCTGTGTGCTGCTGGGG + Intergenic
919066944 1:192703959-192703981 CATTCTGCTCTGTTCTCCTTAGG - Intergenic
919176156 1:194020986-194021008 CATCTTGCTGTGTGCTCATGGGG - Intergenic
919467753 1:197942999-197943021 CAGTGAGCTGTAGGCTCCTGGGG - Intergenic
920218693 1:204379429-204379451 CATTGGACTGTGTGCTCCTTGGG + Intergenic
921711066 1:218373638-218373660 CAGACAGCTGTGTGATCGTGAGG - Intronic
923440834 1:234018638-234018660 GATTCAGCAGTGTGTTCATGAGG - Intronic
924027650 1:239852342-239852364 CTTTAAGCTGTGTGCCCCTCTGG + Intronic
924564439 1:245185111-245185133 CATTCTGCTGTGTGCTAAGGTGG + Intronic
1062918182 10:1257893-1257915 CTTTCAAATGTGTGCACCTGGGG - Intronic
1062961608 10:1576847-1576869 CAGTCTGCTGTGTGGCCCTGGGG + Intronic
1063585093 10:7345136-7345158 CATTCAGCTTTCTGATTCTGTGG - Intronic
1064324468 10:14336050-14336072 CACTCAACTGAGTGCTCATGGGG - Intronic
1065360005 10:24880691-24880713 CACTCATCTGTGTGTTCCTTTGG + Intronic
1065419801 10:25530426-25530448 CAGTCAGGTGTGAGGTCCTGTGG - Intronic
1065870275 10:29950436-29950458 CATCCAGCCGGGTGCTGCTGTGG - Intergenic
1067164868 10:43857249-43857271 CAATCACCTGTGTGCACCTTGGG - Intergenic
1068045519 10:51881397-51881419 CATTCAGCTGTGAGCTCAGCTGG + Intronic
1074260552 10:111848959-111848981 CATGCTGATGTGGGCTCCTGTGG - Intergenic
1074395355 10:113093296-113093318 CCTTCAGCTGTGTGATCTTATGG - Intronic
1075734389 10:124655014-124655036 CCATCACCTGTGTGCCCCTGGGG - Intronic
1076159135 10:128228958-128228980 CATACAGGTGGGTGCTCCTCTGG - Intergenic
1076462226 10:130655289-130655311 ACTTCAGCTCTGGGCTCCTGTGG + Intergenic
1078710072 11:13782865-13782887 CAGGCAGCTGTCTGATCCTGGGG + Intergenic
1078889079 11:15537698-15537720 GCTTCAACTGTGTGCTTCTGAGG - Intergenic
1079721229 11:23816956-23816978 CAAGCAGATGTGTGCTACTGGGG - Intergenic
1080420107 11:32102198-32102220 CAATTAGCTGTGTGACCCTGGGG + Intronic
1081801253 11:45860842-45860864 CATTCAGCTCAATGATCCTGGGG - Exonic
1083083653 11:60120011-60120033 CATTCAGCTGTATGATTCAGTGG - Intergenic
1083426851 11:62592520-62592542 CAGCCTGCTGTGTGCTCCTTGGG - Intergenic
1083503388 11:63132682-63132704 CATACAGGTGGGTGCTCCTCTGG - Intronic
1085798767 11:79567840-79567862 CATTCAGCTGTTTGTCCCTATGG - Intergenic
1087104073 11:94393384-94393406 CAGACAGTTGTGAGCTCCTGGGG + Intronic
1088243843 11:107797625-107797647 CATCCAGCTGTGGGCTCCTTGGG + Intronic
1088920492 11:114257171-114257193 CTTTCAGCCCTGTTCTCCTGGGG + Intergenic
1091277749 11:134363804-134363826 CTCTCAGCTCTGTGCTGCTGTGG + Intronic
1091918239 12:4284407-4284429 CAGTGAGCTGTGTTCTCCAGAGG + Intronic
1095140614 12:38657642-38657664 CATACAGCTGGGTGCCCCTCTGG + Intronic
1096209101 12:49748910-49748932 CATTTAACTGTGGGCTCCTCTGG + Intronic
1096462906 12:51832472-51832494 GATTCAGCTGTGTGGTTATGAGG - Intergenic
1096482150 12:51949603-51949625 GCTTCAGATATGTGCTCCTGAGG + Intergenic
1097407511 12:59208885-59208907 CATTCATCTGTTGGCTCATGGGG + Intergenic
1097911339 12:64973002-64973024 CATTCAGATTTATGCTGCTGGGG - Intergenic
1098174707 12:67778670-67778692 TATTCAGCTGTGTGCACCTGTGG - Intergenic
1099676245 12:85764374-85764396 CATTCACCTGTGTCATCTTGTGG + Intergenic
1100714952 12:97295781-97295803 TATACATCTTTGTGCTCCTGAGG - Intergenic
1100798955 12:98211498-98211520 CAATCAGCCCTATGCTCCTGTGG + Intergenic
1100877334 12:98975699-98975721 CATTCAGGTGTCTGCTCCAAGGG - Intronic
1101580648 12:106038554-106038576 CCTTCTGCTGTGTACTGCTGAGG - Intergenic
1103271990 12:119681080-119681102 CATTCAGCTGGATGATCCTCAGG + Exonic
1103407576 12:120686860-120686882 CATTCAGCTGTGGGATTCCGGGG + Exonic
1104505392 12:129327252-129327274 CACCCTGCTGTGTGCCCCTGGGG - Intronic
1105938130 13:25120714-25120736 CATTGAGCTGCCTGGTCCTGCGG - Intergenic
1106948466 13:34855172-34855194 CCATCAGCTGAGAGCTCCTGGGG + Intergenic
1107176381 13:37404401-37404423 CATTCACTTGTGTGCTACTGGGG + Intergenic
1109126129 13:58519824-58519846 CATTCAGCACTGTGTACCTGTGG - Intergenic
1109563391 13:64078807-64078829 CAGGCATCTCTGTGCTCCTGGGG - Intergenic
1110291500 13:73813000-73813022 CATTCAGCTGAATGCTCTTTGGG - Intronic
1111248581 13:85573620-85573642 CACTCTGCTATGTCCTCCTGTGG - Intergenic
1111788317 13:92819666-92819688 CATTCAGATGTATCCCCCTGGGG + Intronic
1112041953 13:95555729-95555751 CATGCAACTGTGTTTTCCTGTGG + Intronic
1112131035 13:96524238-96524260 CATACAGGTGGGTGCTCCTCTGG - Intronic
1112385524 13:98936057-98936079 CATTCTGGTTTGTGCTCTTGTGG + Intronic
1114412199 14:22511752-22511774 CATTCCCAGGTGTGCTCCTGGGG + Intergenic
1114584717 14:23800103-23800125 AGTTCAGCTGTGTGGTCCTGTGG + Intergenic
1114602984 14:23970735-23970757 CATACAGGTGGGTGCCCCTGTGG + Intronic
1114607345 14:24007861-24007883 CATACAGGTGGGTGCCCCTGTGG + Intergenic
1114769319 14:25410584-25410606 CCTGCAGCAGAGTGCTCCTGGGG + Intergenic
1115360952 14:32501558-32501580 CATTTAGCTGTGTGCCCAGGAGG + Intronic
1118836573 14:69482597-69482619 GTGACAGCTGTGTGCTCCTGGGG - Intergenic
1119778869 14:77265241-77265263 CATCCAGCTGTGTGCCCAGGAGG + Intergenic
1119851889 14:77872247-77872269 CATCCTGCTGTGTGACCCTGAGG - Intronic
1121952482 14:98183749-98183771 CACTGAGCTGTGAGCCCCTGAGG - Intergenic
1122077078 14:99242883-99242905 CAGACAGCTGTGTGCTCCATGGG + Intronic
1122235238 14:100327547-100327569 CCCTCATCTGTGTGCTGCTGAGG - Intronic
1123709109 15:22973566-22973588 CATTCTGCTCTGTTCTTCTGTGG + Intronic
1124724610 15:32145297-32145319 CATACAGGTGGGTGCTCCTCTGG - Intronic
1125841453 15:42804998-42805020 AATTCAGCTGTGTGTTCAGGAGG - Intronic
1128480298 15:68031638-68031660 CATTCTGCTTTGTGATGCTGGGG - Intergenic
1128932433 15:71717532-71717554 AATTCACCTTTCTGCTCCTGAGG + Intronic
1130575646 15:85090807-85090829 CTTTCTGCTATGTTCTCCTGAGG - Intronic
1132087656 15:98921477-98921499 CACTCAGCAGTGAGCACCTGTGG - Intronic
1132671730 16:1104732-1104754 CATTCAGCCCTGAGCTCCCGGGG - Intergenic
1132939552 16:2500078-2500100 CATTCAGCCGTGCGCTGCTCCGG + Intronic
1133834444 16:9353893-9353915 CATTCTTCTGTGTCCTCCTTTGG - Intergenic
1134517231 16:14896996-14897018 AACTCTGCTCTGTGCTCCTGTGG - Intronic
1134704899 16:16295650-16295672 AACTCTGCTCTGTGCTCCTGTGG - Intergenic
1134962643 16:18416464-18416486 AACTCTGCTCTGTGCTCCTGTGG + Intergenic
1134966939 16:18499063-18499085 AACTCTGCTCTGTGCTCCTGTGG + Intronic
1135613410 16:23888421-23888443 CCTCCAGCAGTCTGCTCCTGTGG - Intronic
1136096448 16:27960516-27960538 CACTCAGCTGTGTTCTCCCAAGG - Intronic
1137934025 16:52616802-52616824 CAGTGGGCTGTGTGGTCCTGCGG + Intergenic
1138693819 16:58792769-58792791 CATGCAGCACTGAGCTCCTGGGG - Intergenic
1139131365 16:64149921-64149943 CATTCAGCTGGGTGACACTGTGG + Intergenic
1140027187 16:71301458-71301480 CATGAAGCTGGGTGCTTCTGGGG - Intergenic
1140480273 16:75258748-75258770 GTTTCTTCTGTGTGCTCCTGCGG - Intronic
1141555703 16:84835405-84835427 AAATCTGCTGTGTTCTCCTGCGG + Intronic
1143301596 17:5914694-5914716 CATTCTGCTGCCTACTCCTGGGG + Intronic
1143371958 17:6445839-6445861 CACTCAGCTGTGTATCCCTGAGG + Intronic
1143757329 17:9076447-9076469 ACTACAGCTGTGAGCTCCTGGGG + Intronic
1144498042 17:15762562-15762584 CATTCTGATGTGTGCTCCCAAGG - Intergenic
1145161414 17:20577597-20577619 CATTCTGATGTGTGCTCCCAAGG - Intergenic
1145972340 17:28963760-28963782 AATTCAGCTGTTTGTACCTGTGG + Intronic
1146506658 17:33411583-33411605 CATTCATCTATCTGCTCCAGTGG + Intronic
1148002246 17:44396373-44396395 CAGTCAGCTGGGGGCTTCTGAGG - Intronic
1148960793 17:51391126-51391148 CAGTCAGCTTTGTTTTCCTGAGG - Intergenic
1150187723 17:63202682-63202704 AATTCAGCTCTCTGCACCTGGGG - Intronic
1150503878 17:65678626-65678648 CAGAGATCTGTGTGCTCCTGCGG + Intronic
1151275400 17:73030309-73030331 CATTCAGCTGTCTGATCCAAAGG + Intronic
1152273359 17:79338756-79338778 CAGTCAGCTGTGTGTTCCAGAGG + Intronic
1152296403 17:79469639-79469661 CATCCAGTTGTGTGCAGCTGTGG - Intronic
1152912344 17:83012591-83012613 CCTGCAGCTGTGTGGTCCTGTGG - Intronic
1155631884 18:27904132-27904154 CTTCCTGCTGTGTCCTCCTGTGG + Intergenic
1156856788 18:41791504-41791526 CATCCCCCTGTGTCCTCCTGAGG - Intergenic
1157499780 18:48181528-48181550 CATGCAGCTTTGGGCTCTTGGGG - Intronic
1159114711 18:64101021-64101043 TGTCCAGCTTTGTGCTCCTGAGG - Intergenic
1159394156 18:67834504-67834526 CATTCTTCTGCATGCTCCTGGGG + Intergenic
1160296054 18:77637851-77637873 CATACAGCTGAGTGCCCCTCTGG + Intergenic
1161519881 19:4717977-4717999 CAATCAGCTGGGTGCCTCTGCGG + Intronic
1162325913 19:9999329-9999351 CATGGTGCTGTGTGCACCTGTGG - Intronic
1163014225 19:14443979-14444001 CATGCAGGTGTGTGCACGTGTGG - Intronic
1163130801 19:15271665-15271687 CAGTCAGCTGTGTTGGCCTGCGG - Intronic
1164394870 19:27853439-27853461 CATACAGCTGGGTGCCCCTCTGG + Intergenic
1164596623 19:29534367-29534389 CACTCTGCTGTGAGCCCCTGAGG - Intronic
1165320620 19:35083016-35083038 CTTTCAGCTGTGTGCTCTTGGGG + Intergenic
1165421905 19:35726325-35726347 CATATAGCTGGGTGCACCTGGGG - Exonic
1166217481 19:41344999-41345021 CAGCCACCTGTGTGGTCCTGTGG + Intronic
925193313 2:1902900-1902922 CCTACAGCTGTGTGGACCTGAGG + Intronic
925964891 2:9055472-9055494 CATTCTGCTTTGTGATACTGGGG + Intergenic
926329778 2:11814842-11814864 CATCCAGCCATGTTCTCCTGAGG + Intronic
926941696 2:18144535-18144557 CATACAGCTGGGTGCCCCTCTGG - Intronic
928449720 2:31367486-31367508 TAGTCAGCTGTGTTGTCCTGGGG + Intronic
928584137 2:32741249-32741271 CATCCACCTGTGTACTCCTATGG + Intronic
931250810 2:60529193-60529215 CTTGGAACTGTGTGCTCCTGGGG - Intronic
932144934 2:69308235-69308257 CAACCAGCGCTGTGCTCCTGGGG + Intergenic
932845751 2:75134455-75134477 CAATTTGCTGTGTGCTCCAGAGG + Intronic
933181811 2:79235713-79235735 CATTCAGCTAGGTGCTACAGGGG + Intronic
935070257 2:99687786-99687808 CATTCTGCTGTGAGATCCTAAGG - Intronic
935145708 2:100393818-100393840 CCCTCAGCTGTGACCTCCTGTGG - Intronic
935181962 2:100699627-100699649 CATGCATCTATCTGCTCCTGGGG + Intergenic
936287775 2:111194420-111194442 CATACAGCTGAGTGCTACAGAGG + Intergenic
937606130 2:123803949-123803971 CATACAGCTGAGTGCCCCTCTGG - Intergenic
937636187 2:124157788-124157810 CACCCAACTGTGTGCTCATGAGG + Intronic
937652280 2:124334022-124334044 CAGTCAGCTGTGTGATCTTTTGG - Intronic
937702669 2:124881666-124881688 CATGCAGCTGTGGACTACTGTGG - Intronic
938493056 2:131776005-131776027 TGTTCAGCTCTGGGCTCCTGTGG - Intergenic
938902775 2:135812113-135812135 CATTCACGTCTTTGCTCCTGTGG - Intronic
941414348 2:165200794-165200816 CTGACAGCTGTGTGCTACTGGGG - Intronic
946331732 2:219013430-219013452 CAGGGAGCTGTGTTCTCCTGGGG - Intronic
946411789 2:219518843-219518865 CATTAAGCTGTGTGGCCGTGGGG + Intronic
948907476 2:240986704-240986726 CCCTCTGCTGTGTGCTGCTGAGG + Intronic
1169343420 20:4812812-4812834 CATGCAGCCCAGTGCTCCTGTGG + Intronic
1169388429 20:5170252-5170274 CATTCATCAGTTTGCTCCTCTGG - Intronic
1169794169 20:9443520-9443542 CAATCAGCTGAGTGCTACAGAGG - Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171955315 20:31457451-31457473 TATTCTGCTCTGTGCTGCTGGGG - Intergenic
1173027010 20:39317263-39317285 CATTCTGCTGTGTGATCTTGAGG - Intergenic
1173266907 20:41492151-41492173 CATTAGACTGTGAGCTCCTGAGG + Intronic
1175839317 20:62016655-62016677 CAATAGGCTGTGTGCACCTGAGG - Intronic
1178508229 21:33180460-33180482 AATTCTGCTGTGTGGTCCTGGGG + Intergenic
1179049173 21:37874147-37874169 CATTGGGCTGGGTGCTACTGCGG - Intronic
1179100730 21:38353623-38353645 CACTCAGTTTTGTGCTCCTAGGG + Intergenic
1179535720 21:42050164-42050186 CATTCAGCTGTGTGGTCCAGGGG + Intergenic
1179959766 21:44761673-44761695 CATTCTGCTGTGCGCCCATGGGG - Intergenic
1180692915 22:17732372-17732394 CAGTCTGGTGTGGGCTCCTGTGG - Intergenic
1181853826 22:25768657-25768679 CTTTCAGCTCTGTGGTCTTGGGG - Exonic
1182063147 22:27412215-27412237 CTTTGAGCTGTGTGATCCTGGGG - Intergenic
1183471055 22:38006978-38007000 CTTTCAGATGTGTGCGCCTGTGG - Intronic
1183780988 22:39998664-39998686 CATTCAGCTGTTTACTTGTGGGG + Intronic
1183783053 22:40010985-40011007 CAATCAGCTCTTTGCACCTGGGG - Intronic
1184528430 22:45039452-45039474 CAGACAGCTGTGTCCTCATGCGG + Intergenic
950046553 3:9951815-9951837 CACTCAGCTGTGTGACCTTGGGG - Intronic
953851289 3:46467295-46467317 CATAGTGCTGTGAGCTCCTGAGG - Intronic
954496108 3:50963933-50963955 TATTCAGCAGTGTGCTCATCAGG + Intronic
954539107 3:51382111-51382133 CATCCAGGAGTGTGCTACTGAGG + Exonic
954648944 3:52148375-52148397 TATTGAGCTGTGTTCTTCTGGGG - Intronic
954795224 3:53157989-53158011 CCTTCAGCTGTGTGGGCCTCAGG + Intronic
955923434 3:63982125-63982147 CATTCACCTGGGGGCTGCTGAGG + Intronic
956051349 3:65251721-65251743 CAAACAACTGTGTGCTCCAGAGG + Intergenic
958937701 3:100274949-100274971 CATTCACCTTTGGGCTACTGTGG + Intronic
959182467 3:102999050-102999072 CATTAAACTGTGTGTTACTGAGG + Intergenic
961420127 3:126796642-126796664 CTGTCAGCATTGTGCTCCTGGGG + Intronic
961524719 3:127489416-127489438 CACTCACCAGTGTGTTCCTGTGG - Intergenic
963000682 3:140678957-140678979 TTTCCAGCTGTGTGATCCTGGGG - Intronic
963315745 3:143756824-143756846 GATTCAGCTCTGTGCTTCTTTGG - Intronic
963735066 3:149009842-149009864 CAGGCAGCAGTGTGCTGCTGTGG + Intronic
964583489 3:158267906-158267928 GATTCAGCTGTATTCTCCTGGGG + Intronic
967756918 3:193180128-193180150 CATACAGGTGGGTGCTCCTCTGG + Intergenic
968396517 4:243532-243554 TATTCAGCTGTTTGTTCCTCAGG + Intergenic
970561381 4:17284998-17285020 TATTTTGCTGTGTACTCCTGGGG - Intergenic
970808984 4:20068929-20068951 CATTCAGGTCTGGGCTCCTAAGG + Intergenic
971394720 4:26217352-26217374 CATTCAGCTGTGTGCTCCTGTGG + Intronic
972010732 4:34178057-34178079 TATTCAGCTCTGTTCTCCTGTGG + Intergenic
973789705 4:54366684-54366706 CCTCCAGCTGTGGGCTGCTGTGG + Intergenic
974249637 4:59368450-59368472 AATGCAGCTGTGAACTCCTGGGG + Intergenic
975038133 4:69710109-69710131 CATGCAGATGTGTGCTGCAGGGG - Intergenic
983654940 4:170073467-170073489 CAACCAGCTCTGAGCTCCTGAGG + Intronic
985158937 4:187024116-187024138 CACTCTGCTGTGTGCTCTGGAGG + Intergenic
985929545 5:3046452-3046474 CATTTGGCTGTGTGTTCTTGAGG + Intergenic
986235224 5:5903451-5903473 CATTCAGCTGTACTCTGCTGTGG - Intergenic
986700316 5:10401055-10401077 CAGTCAGCTGGGTGGGCCTGAGG + Intronic
987056763 5:14200483-14200505 CATTCACATCTGTGCTCCTAGGG + Intronic
988559274 5:32265897-32265919 TTTCCAGCTGTGTGATCCTGGGG - Intronic
988730236 5:33965290-33965312 CATTCAGGTTTGTGTTCTTGAGG - Intronic
990065190 5:51704177-51704199 AATTCAGGTGTGTTCTTCTGAGG + Intergenic
990713165 5:58606656-58606678 CATACAGGTGGGTGCTCCTCTGG + Intronic
991403446 5:66277894-66277916 CATTCCTCTGTGGGCTGCTGAGG - Intergenic
991494838 5:67216631-67216653 CATTTTCTTGTGTGCTCCTGGGG + Intergenic
991553557 5:67870116-67870138 CATTCAGGTATGGGCTCATGAGG - Intergenic
991674849 5:69080544-69080566 CATTCTGCTTTGGGCTGCTGGGG + Intergenic
992232317 5:74675580-74675602 CCCTCAGTTGTGTGCTCCAGGGG - Intronic
996230439 5:121057465-121057487 CATTCAGATATCTGCTCTTGTGG - Intergenic
996563869 5:124859165-124859187 CCATCAGCTGTGTTTTCCTGAGG + Intergenic
996998392 5:129726924-129726946 CATTAAGATGTAAGCTCCTGGGG + Intronic
997383199 5:133452023-133452045 CAGCCAGGTGTGGGCTCCTGGGG - Intronic
999616289 5:153428158-153428180 CATTCAGAAGTGTGGTCCTAAGG + Intergenic
1001511036 5:172322108-172322130 ACTGCTGCTGTGTGCTCCTGGGG + Intergenic
1002089166 5:176794367-176794389 CGTTCAGCTCTGGGCACCTGGGG - Intergenic
1002581384 5:180211300-180211322 CACTCAGCTGTGTTGTTCTGGGG + Intergenic
1003017048 6:2476498-2476520 CATTGAGCTGTTTGCTCCTGTGG - Intergenic
1004510111 6:16278167-16278189 CACTCAGCTCTGTGCTCCACAGG - Intronic
1004819616 6:19353136-19353158 CAGTCACCTGTCTGCTTCTGGGG + Intergenic
1004879595 6:19994618-19994640 CCTACAGCTGTGTTATCCTGTGG + Intergenic
1006409385 6:33863509-33863531 CATCCTCCTGTGGGCTCCTGAGG + Intergenic
1006573373 6:35024155-35024177 ATCTCAGCTGTGTGTTCCTGCGG + Intronic
1006793904 6:36720383-36720405 CCTCCTGATGTGTGCTCCTGAGG - Exonic
1006908891 6:37551102-37551124 CTTGCTGCTGTGTGCTCTTGGGG - Intergenic
1007134654 6:39508990-39509012 CATACAGGTGGGTGCTCCTCTGG + Intronic
1010146038 6:72670701-72670723 CTTCTTGCTGTGTGCTCCTGTGG + Intronic
1012369710 6:98488343-98488365 CATTCAGCTGTGGGTCCCTGAGG - Intergenic
1012615710 6:101277355-101277377 CAATTAGCAGTGTGCTCCTCCGG - Intergenic
1012962501 6:105636967-105636989 GAATCAGCTGTGTCCTGCTGTGG - Intergenic
1013777309 6:113692658-113692680 CATTGACCTGTGTCCTTCTGAGG - Intergenic
1017618377 6:156269473-156269495 CATCCAGCTGTGAGCCCATGAGG + Intergenic
1017681478 6:156868558-156868580 CATTGGGCTGTGTCCTCCTATGG + Intronic
1018266317 6:162028478-162028500 CCGGCTGCTGTGTGCTCCTGTGG + Intronic
1018937065 6:168280271-168280293 AAGGCCGCTGTGTGCTCCTGTGG + Intergenic
1019448354 7:1083033-1083055 TATTCCGCCATGTGCTCCTGGGG + Intronic
1022467024 7:30658872-30658894 AATGCAGCTGTGAGCTGCTGGGG + Intronic
1022525694 7:31035621-31035643 CTTGCTGCTGTGTCCTCCTGTGG + Intergenic
1022859920 7:34357196-34357218 CATTCAGATGAATGCTCCTGAGG + Intergenic
1022981691 7:35610549-35610571 CATGCAGCTGTGTCCATCTGGGG - Intergenic
1023481249 7:40636978-40637000 ACTTTTGCTGTGTGCTCCTGGGG + Intronic
1024604316 7:51012024-51012046 CTTTCAGGGGTGTGCTCCTGGGG - Intergenic
1026111437 7:67461807-67461829 GCTTCAGCTGTCTCCTCCTGGGG - Intergenic
1026366033 7:69649381-69649403 CATACAGCTTTGTGTTCCAGTGG + Intronic
1031016166 7:116578924-116578946 CTTTCTGCTGTGTCCTCATGTGG + Intergenic
1031544934 7:123039692-123039714 CATTGAGCTGTGTTTTCCAGTGG + Intergenic
1032001320 7:128267394-128267416 CATTCAGCTGTGTTTTCCCAGGG + Intergenic
1032402055 7:131630354-131630376 CCTTCATCTGTGTGCCCATGGGG + Intergenic
1034250973 7:149690560-149690582 CAGGCAGCTGTCTGCGCCTGTGG + Intergenic
1034908434 7:154972012-154972034 TACTCAGCTGTGTGCTCTAGCGG - Intronic
1035142559 7:156777324-156777346 CACTCAGCTGTGTCCTACTGAGG - Intronic
1035714862 8:1746239-1746261 GATTCAGCTGTGAGGGCCTGAGG + Intergenic
1037157090 8:15715500-15715522 CATCCTGCTGTGTCCTCCTTGGG - Intronic
1037527981 8:19746217-19746239 CAGTCTCCTGTGAGCTCCTGGGG + Intronic
1037659499 8:20914740-20914762 CATTCTGCTGTCTGTTGCTGTGG - Intergenic
1038045913 8:23765473-23765495 AATTCAGCTGTGAGCTGCCGAGG + Intergenic
1038138593 8:24817989-24818011 CTTTCAGCTGTGGGTTCCTCTGG - Intergenic
1039039276 8:33391978-33392000 CATTCATCTGAATGCACCTGAGG - Intronic
1041193269 8:55374738-55374760 TGTTCTGCTGTGTGCCCCTGTGG - Intronic
1041621290 8:59972680-59972702 TATTCAGCTGTGTGCTGATCAGG + Intergenic
1042054052 8:64743885-64743907 GATTCTACTGTGTGCTCATGGGG - Intronic
1042126541 8:65543194-65543216 CATTCTGCTCTGTGCTTCTCTGG - Intergenic
1042802460 8:72734623-72734645 CATTCAGCTTTCTTCTCCCGGGG - Intronic
1042810659 8:72822156-72822178 GAATTAGCTGTGTGTTCCTGTGG + Intronic
1043203057 8:77396475-77396497 CATGCAGCTGTGAGCGCCTCTGG + Intergenic
1047180545 8:122583868-122583890 CACTAAACTGTGAGCTCCTGGGG - Intergenic
1047806362 8:128364933-128364955 CTTTCTGCTGTGTCCTCCAGAGG - Intergenic
1049225512 8:141448810-141448832 CATGCTGCTGTGTGGTCCTCTGG + Intergenic
1050655852 9:7828207-7828229 CATTTGGCTTTGTGCTCTTGTGG - Intronic
1052887797 9:33666767-33666789 CATTCAGCTGGGTGCCCCTCTGG + Intergenic
1053194121 9:36102143-36102165 CTTTCAGCTGTGTGGTCTTCAGG - Exonic
1055365636 9:75541889-75541911 CATTCTGCTGGGTGTTGCTGGGG + Intergenic
1055436302 9:76295475-76295497 CAATCACATGTGCGCTCCTGTGG - Intronic
1055711409 9:79066042-79066064 CATTCAGCTTTTTCCTCCAGGGG - Intergenic
1055955736 9:81772030-81772052 AATTCAGCTGTCTGCTCCATTGG - Intergenic
1056016274 9:82391566-82391588 CATACAGGTGGGTGCCCCTGTGG - Intergenic
1059222384 9:112636784-112636806 TATTCAGCTATATTCTCCTGGGG - Intronic
1059790535 9:117637260-117637282 CATTCTGCAGTGAGCTTCTGTGG + Intergenic
1060023720 9:120153509-120153531 CCCTCAGCTCTATGCTCCTGGGG + Intergenic
1061532295 9:131224079-131224101 AATTCAGCTGTGTACTTATGTGG - Intronic
1061976485 9:134070496-134070518 CTTTCAGCTGTTTGCCACTGTGG - Intergenic
1062075875 9:134589761-134589783 CCCTCACCTGTGTACTCCTGGGG + Intergenic
1186474889 X:9849528-9849550 CTCTCTGCTGAGTGCTCCTGGGG + Intronic
1186533942 X:10328077-10328099 CCTTCAGCTCTCTGCACCTGTGG - Intergenic
1187829104 X:23363028-23363050 CATACAGGTGGGTGCTCCTCTGG - Intronic
1187981900 X:24766298-24766320 TATTCAGCTGTGAGCTCCATTGG + Intronic
1188844096 X:35052600-35052622 CATTCAGCTGGATGACCCTGAGG + Intergenic
1190088741 X:47419184-47419206 CACTGTGCTGTGTGCTCATGTGG - Intergenic
1190979573 X:55443966-55443988 CATACAGCTGGGTGCCCCTCTGG + Intergenic
1191073137 X:56423778-56423800 TATTAATCTGGGTGCTCCTGTGG + Intergenic
1192867631 X:75152359-75152381 CTTTTAGCTGTGTCCTCATGTGG - Intronic
1193419844 X:81270606-81270628 CATACAGGTGGGTGCCCCTGTGG - Intronic
1193646604 X:84077738-84077760 CAGTCAGCTATGTGATCATGAGG - Intronic
1193812186 X:86064694-86064716 CATTCTTCTCTGTGCTTCTGTGG + Intergenic
1197231568 X:124009660-124009682 CTTTAAGTTGTGTGCTCTTGTGG + Intronic
1197931278 X:131698885-131698907 CATTTTGCTCTGTGCTCCTGTGG - Intergenic
1197965033 X:132051085-132051107 CTTTCAGCTGTCTGTTTCTGTGG + Intergenic
1198097348 X:133392940-133392962 CTTTCAGCTTTGTGATCCGGAGG - Intronic
1198275793 X:135096254-135096276 GATTCTCCTGTGTGATCCTGGGG + Intergenic
1198310724 X:135424479-135424501 GATTCTCCTGTGTGATCCTGGGG - Intergenic
1198896707 X:141463557-141463579 CTTTCAGCTGTGTCCTCAAGTGG + Intergenic
1200083594 X:153591835-153591857 CAGTCAGCTGTGAGTGCCTGAGG - Intronic
1200244888 X:154517632-154517654 CTTTCAGCTGCCTGCTGCTGGGG + Intergenic