ID: 971395358

View in Genome Browser
Species Human (GRCh38)
Location 4:26222038-26222060
Sequence TCTAGGGCCCCTCGTCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971395358 Original CRISPR TCTAGGGCCCCTCGTCAAAG TGG (reversed) Intronic
903321998 1:22548779-22548801 TCTAGGCCTCCTCTGCAAAGCGG + Intergenic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
907305452 1:53510457-53510479 TCCAGGGCTCCTCGTCCAGGTGG - Intronic
1075052262 10:119191524-119191546 TCTGGGGCTCCTCTTCAATGAGG - Intergenic
1076135647 10:128044280-128044302 TCTAGGGCCCCTGGGGAAGGAGG + Intronic
1087236330 11:95722953-95722975 ACTAGGGCCCCTTGGCAAAATGG + Intergenic
1088324943 11:108592342-108592364 TCCAGGGACCCTCTTCAAATTGG - Intronic
1117378878 14:55140112-55140134 TCTTTGGCCCCTGGGCAAAGTGG + Intronic
1118821212 14:69347295-69347317 TCTAGGGGCCCCTGGCAAAGTGG - Intronic
1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG + Intergenic
1133465748 16:6025467-6025489 TCTGGGGCCTCCCTTCAAAGAGG + Intronic
1140029209 16:71321160-71321182 TCTTGGGCCCCTCATCGGAGAGG + Intergenic
1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG + Intronic
1150386781 17:64767715-64767737 TCTAGGGCCACCCCTCCAAGTGG + Intergenic
1152480980 17:80552389-80552411 TCTAGGTCCCTTCCTCAGAGAGG + Intronic
1160704166 19:521846-521868 TCTTGGGACCCTCCCCAAAGAGG - Intergenic
1161767778 19:6216568-6216590 TCCAGGGCCCCTCGCCCATGAGG + Intronic
1163034524 19:14563292-14563314 CCTAAGGTCCCTGGTCAAAGGGG - Intronic
925873628 2:8293095-8293117 TCTAAGGGCCCTTGTCAAACAGG - Intergenic
948891817 2:240910529-240910551 TCTCGAGCCCCTCAGCAAAGAGG - Intergenic
1181772924 22:25139760-25139782 TCTATGTTCCCTCCTCAAAGAGG - Intronic
1184598751 22:45530025-45530047 TGTAGGGCCCCTGGTCACAGAGG + Intronic
1184787459 22:46678783-46678805 TCTGCGGCCCCTCGTGAAGGGGG - Exonic
950027831 3:9832987-9833009 TCTGAGGCACCTGGTCAAAGAGG - Intronic
956050532 3:65243454-65243476 TCTAGGGCCTCTTGCCACAGTGG - Intergenic
965529660 3:169758574-169758596 TCTAGAGCCCCTCTCCAAGGAGG - Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
984010853 4:174369795-174369817 TCTTGGCCCCCTCAGCAAAGTGG + Intergenic
990024378 5:51167505-51167527 TCTAGGTACCCTCATAAAAGTGG + Intergenic
990409513 5:55527179-55527201 TCTGGGTCCCTTCCTCAAAGGGG - Intronic
991564695 5:67992562-67992584 TCTTGGGGCCATGGTCAAAGAGG + Intergenic
996345484 5:122483943-122483965 TCTAGGGCCCCTTGTTAAAAAGG - Intergenic
997241210 5:132309461-132309483 TCTTGGGCCCCTCTTCAGGGAGG + Intronic
1002895889 6:1379894-1379916 TCTAGGGCTCCACTGCAAAGAGG - Intergenic
1006812309 6:36827753-36827775 TCTCGGGCCCTTCGTCAGGGCGG - Intronic
1012001400 6:93659520-93659542 TCTAGGGTCTTTCCTCAAAGAGG - Intergenic
1023225050 7:37960456-37960478 TAAAGGGCACCTCGTCAAAGAGG - Intronic
1023395240 7:39745755-39745777 TCCAGGGCCCCTGGTCAACGAGG - Intergenic
1031778127 7:125926803-125926825 TCTAGGGCTCTTATTCAAAGCGG - Intergenic
1033757088 7:144404146-144404168 TCTAGAGCCACTCCTCAAAGGGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1043305436 8:78787736-78787758 TCCACGGCCTCTCTTCAAAGTGG + Intronic
1049090885 8:140512367-140512389 GCTGGGGCCCCTCGTCTAAGAGG + Intronic
1049522949 8:143103899-143103921 TTTAGGGCCACCCTTCAAAGGGG + Intergenic
1053475042 9:38376571-38376593 CCCGGGGCCCCTCGTCAAGGAGG + Intergenic
1059431434 9:114252754-114252776 GCTAGGCCCCCTGGACAAAGAGG - Intronic
1059593670 9:115692717-115692739 TCTAAGGCCTCTCTTCTAAGAGG - Intergenic
1061283701 9:129610814-129610836 TCTACGGCCCCTCCTCCAGGTGG - Intronic
1062487587 9:136787695-136787717 TCTTGGGCCCCTCTTCCAGGTGG + Intergenic
1199270525 X:145877658-145877680 TCCAGGGCCCCTCTTCGATGAGG - Intergenic
1202247620 Y:22835919-22835941 TCCAGGGCCATTCCTCAAAGAGG + Intergenic
1202400608 Y:24469667-24469689 TCCAGGGCCATTCCTCAAAGAGG + Intergenic
1202470172 Y:25200419-25200441 TCCAGGGCCATTCCTCAAAGAGG - Intergenic