ID: 971395571

View in Genome Browser
Species Human (GRCh38)
Location 4:26224132-26224154
Sequence CTGACACAGAACATCTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971395571 Original CRISPR CTGACACAGAACATCTATCT TGG Intronic
901184934 1:7366856-7366878 CTGATACAGCTCATCTGTCTGGG + Intronic
902178396 1:14668972-14668994 CAGACAGAGAACATTTATCATGG + Intronic
905158432 1:36009120-36009142 CTCATACAGAACATTTATTTTGG + Intronic
907443262 1:54491111-54491133 CTGACACAGATTTTCTGTCTTGG + Intergenic
911886916 1:103313583-103313605 CTGATCAAGAACATCTATTTGGG - Intergenic
912987937 1:114453643-114453665 TTGACACAGACTATCTAGCTTGG - Intronic
915495070 1:156276514-156276536 CTGACCCAGAATGTCTGTCTTGG + Intronic
915587805 1:156853722-156853744 CTGGCACAGAACATGAATGTAGG - Intronic
916396825 1:164399720-164399742 GTGACAAAAAACATCTATTTGGG + Intergenic
1063082550 10:2782311-2782333 CTGACACCAAAGATCTATTTTGG - Intergenic
1064013006 10:11750692-11750714 CTGAAACTGAAAATCTATTTGGG + Intronic
1066329196 10:34399680-34399702 ATGACACAGAACATTTCTCTTGG + Intronic
1075570035 10:123534921-123534943 CTGACAAAGAAAATCTGGCTAGG + Intergenic
1078967376 11:16361693-16361715 CTGACACACAACAGCTGTTTAGG + Intronic
1085915951 11:80887959-80887981 CTGACAAATAACTTATATCTAGG - Intergenic
1090272256 11:125395815-125395837 CTGACAAAGGACTTGTATCTAGG - Intronic
1090455213 11:126843158-126843180 ATGACACAGAGCAGCTCTCTGGG + Intronic
1090677903 11:129020946-129020968 CTGTCTCAGAAAAGCTATCTGGG + Intronic
1091940464 12:4475837-4475859 ATGTCACTGAACTTCTATCTGGG - Intergenic
1091996426 12:4997609-4997631 ATGACACAGAGCATCTTTCACGG + Intergenic
1093748621 12:22772444-22772466 CTGACTGAGAGCTTCTATCTTGG + Intergenic
1093870190 12:24281831-24281853 TTGACACAGAACAGCTAGCTAGG + Intergenic
1098548622 12:71738764-71738786 CAGACACAGAACCTTGATCTTGG - Intergenic
1102744728 12:115240429-115240451 CTGACACAGCACATATAGATCGG - Intergenic
1107958176 13:45537776-45537798 ATGGCCCAGCACATCTATCTTGG - Intronic
1112155879 13:96816449-96816471 CTGTCCCAGAACATGTCTCTTGG + Intronic
1112798270 13:103081500-103081522 CTTATACAGAACATCTATGCTGG - Intergenic
1113848252 13:113404281-113404303 CTGACCCTGAGCCTCTATCTGGG + Intergenic
1114166804 14:20226926-20226948 CTGACACAGGACTTCCATATTGG + Intergenic
1115161151 14:30396056-30396078 CTGACAAAGGACTTGTATCTAGG - Intergenic
1117081263 14:52154569-52154591 CTGCCCCAGAACATTTCTCTTGG - Intergenic
1117750719 14:58920651-58920673 TTGACAAAGGACTTCTATCTAGG + Intergenic
1118908486 14:70041578-70041600 CTGACCAAGAACATCTTTATTGG + Intergenic
1120440673 14:84534660-84534682 CTGAGACAGAAACTCGATCTTGG + Intergenic
1122295487 14:100703464-100703486 CAGCCACAGAACACCTCTCTGGG + Intergenic
1124901644 15:33828799-33828821 GTTACCCAGAAGATCTATCTAGG + Intronic
1125606987 15:40945069-40945091 CATACACAGAAAATCTCTCTTGG + Intergenic
1126261455 15:46697765-46697787 CTGACACAGAATATCCTGCTTGG + Intergenic
1130612629 15:85375350-85375372 CTGATACAGAGCCTCTATCTAGG - Intergenic
1133564463 16:6980244-6980266 CTGACACAGCACATTTGTATAGG - Intronic
1135743565 16:24997389-24997411 ATGACAGAGAATATATATCTGGG - Intronic
1135831266 16:25775863-25775885 ATGGCACAGACCATTTATCTTGG + Intronic
1135862240 16:26067274-26067296 CTGATTCAGAACTTCTCTCTAGG - Intronic
1141560231 16:84862960-84862982 CTAAGACAGACCATGTATCTGGG + Intronic
1144357674 17:14461551-14461573 CTGACAAAGAACAGCTTTCACGG + Intergenic
1145296698 17:21598545-21598567 CTGGCACTGACCATCCATCTAGG + Intergenic
1145367080 17:22273533-22273555 CTGGCACTGACCATCCATCTAGG - Intergenic
1145794170 17:27645894-27645916 CTTACAGAGAACATCTGTCCAGG - Exonic
1145808972 17:27753435-27753457 CTTACAGAGAACATCTGTCCAGG - Intergenic
1146303543 17:31710644-31710666 CTTTCATATAACATCTATCTGGG - Intergenic
1146762771 17:35492681-35492703 CTGACACAAAACCTCCAACTTGG - Intronic
1149658773 17:58323949-58323971 ATGATACAGAACCCCTATCTTGG - Intronic
1150673166 17:67220119-67220141 CTGGCAGAGAACATATATGTAGG - Intronic
1151287239 17:73121735-73121757 CTGACACAGAGCATCTGTTAGGG + Intergenic
1154997489 18:21654541-21654563 CTAAAAGTGAACATCTATCTTGG + Intronic
1155427911 18:25725251-25725273 CTGAAACAGGATATCAATCTGGG + Intergenic
1156260293 18:35439929-35439951 CAGACACAGGACTGCTATCTTGG - Intergenic
1156793491 18:41009141-41009163 CTGATATGCAACATCTATCTAGG - Intergenic
1157352676 18:46903311-46903333 CTGACAAAGGACTACTATCTAGG + Intronic
1157509445 18:48259751-48259773 ATGACACAGAACATTTTTCATGG - Intronic
1162865645 19:13544505-13544527 CTGGGAGAAAACATCTATCTCGG + Intronic
1168218518 19:54943882-54943904 GTGACACAGCACATGTTTCTGGG - Intronic
1168569511 19:57454209-57454231 CTGGAACAGAACATGTATTTTGG - Intronic
927465677 2:23334559-23334581 CTGTCCCAGAACATCCATCCGGG + Intergenic
927807503 2:26161108-26161130 CTGACACAAAACCTCTCTTTTGG + Intergenic
932400694 2:71479166-71479188 CTGACACAGAACTTTTATTTGGG - Intronic
934886374 2:98029030-98029052 CGGACACAGAATATTTTTCTTGG + Intergenic
936247532 2:110841659-110841681 ATGACACAGAAGCACTATCTGGG + Intronic
937002520 2:118480844-118480866 ATGACAAAGAACATGTATCCCGG + Intergenic
938934060 2:136113213-136113235 CTGGCACAGAAAATCCATTTTGG - Intergenic
941499905 2:166261273-166261295 CTGAGGCAGGACATTTATCTGGG - Intronic
941775273 2:169386759-169386781 CTGACACAGTTCATCTACTTTGG - Intergenic
944391052 2:199220086-199220108 CTGACACAGAAAAATTATTTTGG + Intergenic
945325416 2:208476704-208476726 CTAACACATAGCATCTCTCTTGG + Intronic
945491175 2:210457151-210457173 CTGTCACAGAACATCCATGGTGG + Intronic
946963752 2:225013825-225013847 TTGACACAGAAAATCCATCATGG + Intronic
1170877259 20:20262087-20262109 CTGCCACAGAAATTGTATCTGGG - Intronic
1172419900 20:34807357-34807379 CTGAAACAGAAGACCCATCTAGG + Intronic
1176977677 21:15341084-15341106 TTGCCACAGGACAACTATCTGGG + Intergenic
1177175190 21:17695015-17695037 CTGACACAGCACATGTTTCAGGG + Intergenic
1177888913 21:26781298-26781320 CTGACACAGATGATCTATTGAGG - Intergenic
1178661937 21:34514212-34514234 CAGCCACAGAACATGTTTCTAGG - Intronic
1179466103 21:41574386-41574408 CTGCCACAGAACATCGATAGTGG - Intergenic
1181940775 22:26474687-26474709 CTGACAAAGAACTGGTATCTAGG + Intronic
1185227770 22:49662893-49662915 CAGACACAGCTCATCTATCACGG + Intergenic
1185296131 22:50056168-50056190 CTGACAAAGAGCATGTATCCAGG + Intronic
951918503 3:27827200-27827222 CTGACAGAAAACATCTATCTGGG - Intergenic
954454555 3:50590715-50590737 CTGTCACAGCAAATCAATCTGGG + Intergenic
959739693 3:109703113-109703135 CCGACACAGATTAACTATCTAGG - Intergenic
960038427 3:113124989-113125011 CTTCCACAGAACATCTAGCTAGG + Intergenic
961562760 3:127741789-127741811 CTGACACAAAACAGGTATTTAGG - Intronic
965992480 3:174836836-174836858 CTGACACACAAAATTTAGCTTGG + Intronic
966091714 3:176146095-176146117 CTCAGACAGAATATCTTTCTGGG - Intergenic
969985771 4:11209063-11209085 CTGACACAGGAAAACTCTCTAGG - Intergenic
971395571 4:26224132-26224154 CTGACACAGAACATCTATCTTGG + Intronic
976811566 4:89105642-89105664 TTGAGCCAGAGCATCTATCTGGG - Intronic
978598628 4:110405113-110405135 CTGACAAAGGGCACCTATCTGGG - Intronic
978972353 4:114824266-114824288 CTGACACAGAAAATATAATTTGG + Intergenic
984645304 4:182212819-182212841 ATGACAGAGAACATCCATTTGGG - Intronic
984859168 4:184220655-184220677 CTCACAGAGCACAGCTATCTGGG - Intronic
985785225 5:1889782-1889804 CTGGCAGGGAACATCTGTCTGGG + Intergenic
986205200 5:5617825-5617847 CTGACAAAGAATATGTATCCAGG - Intergenic
986234967 5:5900600-5900622 CTGACATAGTACAGCTATTTTGG + Intergenic
987804813 5:22750576-22750598 TTGACTCAGAATATCTCTCTGGG - Intronic
987817780 5:22926093-22926115 AGGAAACAAAACATCTATCTGGG + Intergenic
988128180 5:27070496-27070518 CTGACACAGGAAAGCTATATAGG + Intronic
991947670 5:71915370-71915392 CTGAGAAGGAACATCTACCTTGG + Intergenic
996249274 5:121308358-121308380 TTGACACAGAATATAAATCTAGG - Intergenic
998258070 5:140604923-140604945 TTGACACAGAACAACTGTATAGG - Intergenic
999103915 5:149052141-149052163 CTGCCACAGAACATTAATCCAGG - Exonic
1002562831 5:180093868-180093890 CTGACCCACATCATCTTTCTTGG + Intergenic
1005590654 6:27322583-27322605 CTGACAATGAACTTGTATCTAGG - Intergenic
1005728670 6:28674408-28674430 CTGACACCGAAGCTTTATCTGGG + Intergenic
1010301476 6:74265206-74265228 CAGACCCAGAACATCTATTTGGG - Intergenic
1014517160 6:122393958-122393980 CTAACACATTCCATCTATCTTGG + Intergenic
1020412713 7:7911113-7911135 CTGCCACAGAGTATCAATCTTGG - Intronic
1023673444 7:42604386-42604408 ATGACACAGATCCTCTATGTTGG - Intergenic
1023778436 7:43633187-43633209 GTTACACAGAAGATCTAGCTTGG - Intronic
1026715286 7:72783726-72783748 CTGACACAGTAATTCTATTTTGG + Intronic
1028125741 7:87110896-87110918 CTGATACAGAGCATCCCTCTTGG - Intergenic
1032742199 7:134750055-134750077 AAGACACAGACCAACTATCTTGG + Intronic
1034329004 7:150266673-150266695 CTGACAAAGAATTTGTATCTAGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1042192785 8:66204818-66204840 GTGAGACAGAACAGCTATCTTGG + Intergenic
1045264267 8:100605628-100605650 CTGACACTGATCCTCTCTCTGGG - Intronic
1047036652 8:120946984-120947006 GTGACAGATAACATTTATCTGGG - Intergenic
1051129060 9:13838941-13838963 GTGACACAAAATATTTATCTTGG - Intergenic
1054748733 9:68882695-68882717 CTGACACAGAACTTCCTTATGGG - Intronic
1057203127 9:93154191-93154213 CTGAAAAAGAACATGTATCCAGG - Intergenic
1058401169 9:104621443-104621465 CTGTCCCAGAACCTCTAACTAGG - Intergenic
1058561550 9:106234161-106234183 CTAACATAGAACAGCTATCCAGG + Intergenic
1186662959 X:11687636-11687658 CTGCCACACAACAGCTATGTGGG - Intergenic
1188099134 X:26061219-26061241 CTGACCCATAACTTCTACCTGGG - Intergenic
1188623070 X:32250543-32250565 CTGACACAAAACATTTTTCTTGG + Intronic
1200853866 Y:7916202-7916224 GTGTCACAGATCATCCATCTAGG - Intergenic