ID: 971399322

View in Genome Browser
Species Human (GRCh38)
Location 4:26261429-26261451
Sequence AAGTAGAAAAGAAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971399317_971399322 7 Left 971399317 4:26261399-26261421 CCAACCAAAAAAGCTAATTTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
Right 971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG No data
971399315_971399322 27 Left 971399315 4:26261379-26261401 CCTTAAGAAAATATGTTATGCCA 0: 1
1: 0
2: 1
3: 26
4: 261
Right 971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG No data
971399319_971399322 3 Left 971399319 4:26261403-26261425 CCAAAAAAGCTAATTTGGGCTTT 0: 1
1: 0
2: 1
3: 21
4: 223
Right 971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971399322 Original CRISPR AAGTAGAAAAGAAATGAGGA AGG Intronic
No off target data available for this crispr