ID: 971400501

View in Genome Browser
Species Human (GRCh38)
Location 4:26271281-26271303
Sequence GATTTCAGGCATCCACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 7, 2: 23, 3: 84, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971400501 Original CRISPR GATTTCAGGCATCCACTGGA GGG Intronic
900549208 1:3245611-3245633 GACCTCAGGCATCCTGTGGACGG - Intronic
900664956 1:3808999-3809021 GAGTCCAAGCATCCTCTGGAGGG + Intergenic
902634253 1:17724779-17724801 GATTACAGGCATCCACTACCAGG - Intergenic
904109592 1:28115242-28115264 GTTTTTAGGCATCTATTGGAGGG - Intergenic
904519560 1:31084206-31084228 AGTTTCAGGCATTCACTGGGAGG - Intergenic
905065283 1:35175755-35175777 GATTTTGGGCATCCACTGTGGGG - Intergenic
905929285 1:41775827-41775849 GATTTCATGGATTCACTGTATGG + Intronic
906428857 1:45738088-45738110 AGTTTCAGGCATCCACTGGGGGG + Intronic
906758142 1:48341893-48341915 GGTTTCAGGCATCCACTAAGGGG + Intronic
907984854 1:59520760-59520782 GATTCCAGGCATCCTCAGCAGGG - Intronic
909358464 1:74734608-74734630 GGTTTCAGGCATCCACTAGGGGG + Intronic
909580152 1:77224269-77224291 GATTTCAGGTATCCACTGGGGGG - Intergenic
910415880 1:86997672-86997694 GGTTTCAGGCATCTACTGGGGGG - Intronic
910516089 1:88061656-88061678 GAGCTCAGTCAGCCACTGGAGGG - Intergenic
912871068 1:113307144-113307166 GGTTTCAGGCAACCACTGGGGGG - Intergenic
912891898 1:113542145-113542167 GGTTTCCGGCATCCACTGGGGGG - Intronic
913488092 1:119352292-119352314 AGTTTTAGGCATCCACTGGGAGG + Intergenic
915050697 1:153069076-153069098 GAGTTCAGGCATCCGTTTGATGG - Intergenic
915652434 1:157325874-157325896 GAGTTCAGGGATTCTCTGGAGGG - Intergenic
917857795 1:179115663-179115685 GGTTTCAGGCATCCAAGGGGGGG + Intronic
919110346 1:193211161-193211183 GGTTTCAGGTATCCGCTGGGGGG - Intronic
919381022 1:196861479-196861501 TATTTCAGGCATCTGCTGGGGGG - Intronic
920618360 1:207518626-207518648 GATTGCCAGCAGCCACTGGAAGG - Intronic
920634796 1:207690765-207690787 GATTGCCAGCAGCCACTGGAAGG - Intronic
921592111 1:217016051-217016073 GATTTCAGGAGTAGACTGGAAGG + Intronic
921678848 1:218007951-218007973 GATATCAGGGATTCTCTGGAGGG - Intergenic
921912059 1:220560290-220560312 AGTTTCAGCCATCCACTGGGGGG - Intronic
923746541 1:236705925-236705947 AATTTCAGGCTTCCACTGCCAGG - Intronic
924759487 1:246970902-246970924 GATTACAGGCATGCGCTGTAGGG + Intronic
924866655 1:247990155-247990177 AATTTCAGGCATTCACTGGCGGG + Intronic
924953771 1:248908415-248908437 GATTTCAGGCACCCTATGGCTGG - Intronic
1065010191 10:21414115-21414137 GGTTTCAGACTTCCACTGGGGGG - Intergenic
1065436908 10:25712189-25712211 GGTTTCAGGCATCCACTAGTGGG + Intergenic
1065455836 10:25905822-25905844 GGTTTCAGGCATTCACTGGGGGG + Intergenic
1066107403 10:32167902-32167924 GATATCATGCAGCCATTGGAAGG + Intergenic
1066205982 10:33189622-33189644 GACTTCAGGAATCCTCTGAAAGG + Intronic
1068161437 10:53270283-53270305 AGTTTCAGGCTTCCACTGGGGGG - Intergenic
1068338187 10:55665628-55665650 GGTTTCAGGCAGCCACTGGGGGG + Intergenic
1069300989 10:66907502-66907524 GATTTCAGGAAGCAACTGAAAGG - Intronic
1070507106 10:77123641-77123663 GGTTTCAGGCATCCACTGGGAGG - Intronic
1073842821 10:107517568-107517590 GGTTTCAGGCATCCACTGGGGGG + Intergenic
1073917236 10:108419795-108419817 GGTTTCAAGCATCCACTGGGGGG - Intergenic
1074180867 10:111061556-111061578 GCTATCAGGCATCCCATGGAAGG + Intergenic
1074330757 10:112506383-112506405 GATTTCAGACATCCACAGGGAGG + Intronic
1074892330 10:117746109-117746131 GATTTCAGGCTTTGGCTGGAAGG + Intergenic
1076788385 10:132763096-132763118 GATTTCAGGAAGGCACTGGCAGG - Intronic
1081738286 11:45420461-45420483 GCTTTCAGTGATCCGCTGGAAGG - Intergenic
1081982519 11:47277155-47277177 GGTTTGAGGCATCCACTGGTGGG - Intronic
1084034423 11:66499967-66499989 GGCTTCAGGCATCCACTACATGG + Intronic
1084754595 11:71228618-71228640 GATTACAGGCACCCACTACAAGG - Intronic
1084759025 11:71256587-71256609 AGTTTCGGGCATCCACTGGGGGG - Intergenic
1085891438 11:80584667-80584689 GCTTTCTGACATCCAATGGAAGG + Intergenic
1087217153 11:95506483-95506505 TGTTTCAAGCATCCACTGGGGGG + Intergenic
1088284703 11:108175309-108175331 AATTTCAGGCACCCACTGGGGGG + Intronic
1088760380 11:112923705-112923727 GGTTTCAGGCATCCACTGAGGGG - Intergenic
1088832411 11:113548624-113548646 AGTTTCAGGCATCCACTGGGGGG + Intergenic
1088902847 11:114131550-114131572 GAATTTGGGCATTCACTGGAGGG - Intronic
1090452861 11:126821850-126821872 GAATCCAGGCAGCCTCTGGAAGG + Intronic
1090622669 11:128575119-128575141 GGTTTCAGGCCTCCACTGGAGGG - Intronic
1090681358 11:129061380-129061402 GATTTCAGGCATTCCCTGAGTGG - Intronic
1091496218 12:975185-975207 GGTTTCAATCATCCACTGGGAGG + Intronic
1092030551 12:5280082-5280104 GATCTCAGGCATCTGCTGTAGGG - Intergenic
1092894410 12:12999181-12999203 CGTTTCAGGTATCCACTGGGGGG - Intronic
1093189267 12:16056694-16056716 GATTTCAGGCATCCTCCTGAAGG + Intergenic
1095546630 12:43379051-43379073 GAATTCCGGCAGCCACTGGAGGG + Intronic
1095994868 12:48072854-48072876 GGTTTCAAGCATCCACTGGTGGG + Intronic
1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG + Intronic
1098850100 12:75585983-75586005 GGTTTCAGGCATCCACTGGGGGG + Intergenic
1099756870 12:86862746-86862768 GGTTTTAGGCATCCACTGGGAGG - Intergenic
1100877080 12:98973974-98973996 AGTTTCAGGCATCCACTGGGTGG + Intronic
1101472912 12:105015733-105015755 TGTTTCAGGCATCCTCTGGGGGG + Intronic
1102412235 12:112730097-112730119 GATTTCTGGCAACCACCAGATGG + Intronic
1102800020 12:115723981-115724003 AATTTCAGGCATTTACTAGAAGG + Intergenic
1103256643 12:119547440-119547462 CATTTCTGGCATCAACTGAATGG + Intergenic
1104800087 12:131548490-131548512 GGTTTCAGGCATCCACTGGGGGG - Intergenic
1105401503 13:20100169-20100191 GGTTTCTGACATCCACTGGGGGG - Intergenic
1105465816 13:20639048-20639070 CATTTCAGGCAACCGCTGAAAGG - Intronic
1105851883 13:24342292-24342314 GTTTTCATGCATCAACTTGACGG - Intergenic
1106615870 13:31327077-31327099 GGTTTCAAACATCCACTGGGGGG - Intronic
1106784383 13:33092443-33092465 GATTTCAGGCATCAGCAGGTAGG - Intergenic
1107365885 13:39674875-39674897 AGTTTCAGGCATCCACTGGAGGG + Intronic
1108465393 13:50709904-50709926 GGTTTCAGGCATCCACTGGGAGG - Intronic
1112073466 13:95881234-95881256 GGTTTCAGGTATCCACTGAGTGG + Intronic
1113394293 13:109931523-109931545 TATTTCAGACATACACAGGAAGG - Intergenic
1113716693 13:112514273-112514295 GGTTTCAGGCATCCATGGGGTGG + Intronic
1115801827 14:37003059-37003081 GGTTTCAGGCATCCGCTGGGGGG - Intronic
1117566180 14:56995775-56995797 GATTTCTGGCATCCCCTACAGGG + Intergenic
1118380164 14:65211641-65211663 GGTTTCAGGTATCCACTGGGGGG + Intergenic
1118411019 14:65478249-65478271 GGTTTCAGGTATCCACTGGGGGG - Intronic
1118447552 14:65865657-65865679 GATATCAGGAATCCACCGGAAGG + Intergenic
1120024846 14:79571147-79571169 TATTGCAGGCATCCATTGGGTGG - Intronic
1120070287 14:80095122-80095144 ATTTTCAGGCATTCACTGGGGGG + Intergenic
1121147639 14:91599066-91599088 GATATCAGGGATTCATTGGAGGG + Intronic
1121175072 14:91884888-91884910 TATTTCAGCTTTCCACTGGAGGG - Intronic
1121722705 14:96121893-96121915 AGTTTCAAGCATCCACTGGGAGG - Intergenic
1122631169 14:103108424-103108446 GATCTCAGCCACGCACTGGATGG - Exonic
1125213663 15:37244342-37244364 GGTTTCAGGCATCCGCTGGGGGG + Intergenic
1125361404 15:38868104-38868126 AGTTTCAGGCATTCACTGGGGGG + Intergenic
1125877301 15:43161115-43161137 GTTTTCAGGCATCCACTGGGGGG + Intronic
1126028176 15:44469181-44469203 GGTTTCAGACAACCACTGGAGGG + Intronic
1126044709 15:44628084-44628106 GAATTCCTTCATCCACTGGAGGG - Intronic
1126486743 15:49189426-49189448 GGTTTCAGGCATCTACTGAGGGG - Intronic
1127542769 15:59958708-59958730 AGTTTCAGGCATTCACTGGGGGG + Intergenic
1129104495 15:73296675-73296697 GACTTCAGGCCTCCACTGCGGGG - Intronic
1130658507 15:85810845-85810867 CGTTTCAGGCATTCACTGGGGGG + Intergenic
1130767302 15:86883940-86883962 AGTTTCAGGCATCCACTGGGGGG - Intronic
1131409062 15:92190648-92190670 AGTTTCTGGCATCCACTGGGGGG - Intergenic
1131602290 15:93861933-93861955 GGTTTCTGGCAACCACTGCAGGG + Intergenic
1133781311 16:8941318-8941340 GATTTCATGCATCCCCTAAAGGG + Intronic
1133799225 16:9071507-9071529 GATCTCTGGCATCCAGTGGGTGG - Intergenic
1134387816 16:13790386-13790408 GGTTTCCGGCACCCACTGGGGGG - Intergenic
1136176202 16:28518652-28518674 GGTTTCAGGCATCCACTGCGGGG + Intergenic
1137614351 16:49838051-49838073 GACTTCATTCATTCACTGGATGG - Intronic
1137983815 16:53091219-53091241 GCTGTCAGCCAACCACTGGATGG - Intronic
1138796315 16:59973872-59973894 GGCTTCAGGCATCCCCTGGGGGG - Intergenic
1139397597 16:66652816-66652838 GATTTCAGAAAACCACAGGACGG + Intronic
1139761823 16:69190211-69190233 GTTTTCAGACATCTAATGGAAGG - Intronic
1141190736 16:81822886-81822908 GATTGCAGGCGGCCACTGCAAGG + Intronic
1141565324 16:84897752-84897774 GATTACAGGCACCCACTGCCAGG + Intronic
1141866816 16:86755946-86755968 GATTACAGGCATGCACTGGTGGG - Intergenic
1143237125 17:5412482-5412504 AGTTTCAGGCATTCACTGGGGGG + Intronic
1143320322 17:6064340-6064362 GGGATCAGCCATCCACTGGAAGG - Intronic
1143573132 17:7773499-7773521 GGTGTCAGGCATCTACTGGGGGG - Intronic
1144498466 17:15765231-15765253 GATTTCAGGCAGCTCCTGGCTGG - Intergenic
1145066957 17:19767958-19767980 GGTTTCAGACATCCACTGGGGGG + Intergenic
1145161848 17:20580272-20580294 GATTTCAGGCAGCTCCTGGCTGG - Exonic
1149455749 17:56786647-56786669 GGTTTCAGACATCCACTGGGGGG - Intergenic
1149710783 17:58740210-58740232 GGTTTCAGGTATCCACTGGGGGG - Intergenic
1149881414 17:60295866-60295888 GGTTTCAGACATCCACTGGGAGG + Intronic
1150171720 17:63003376-63003398 CATTTCAGGCATCCACTGTGGGG - Intergenic
1152101452 17:78304218-78304240 GAGGTCAGGCATCCTCTGGGAGG + Intergenic
1154285197 18:13048743-13048765 GGTTTCAGGTATCCACTTGGAGG + Intronic
1154372343 18:13775484-13775506 GATTTAGGGTATCCATTGGAAGG - Intergenic
1154953306 18:21230757-21230779 TGTTTTAGGCATCCACTGGGGGG + Intergenic
1155124965 18:22864953-22864975 AATTTCAAGCATCTACTGGAGGG - Intronic
1155629986 18:27882014-27882036 GGTTTTCGGCATCCACTGGAGGG + Intergenic
1156312149 18:35934584-35934606 GGTTTCAGGTATCCACTGGGGGG + Intergenic
1156461710 18:37325058-37325080 GAATTCAGGCTTCCCCTGCAAGG + Intronic
1157860387 18:51135899-51135921 GGTTTCAAGCATCCACTAGGGGG + Intergenic
1158664762 18:59422483-59422505 GACTTGAGGCAGACACTGGAAGG + Intergenic
1159464429 18:68762887-68762909 GGTTTTAGGCATCCACTGGAGGG + Intronic
1159958670 18:74538714-74538736 GATTCCCGGCATCCTCTGGGTGG + Intronic
1168683016 19:58329812-58329834 GGTTTCAGGCATCCACTGGAGGG + Intronic
925085611 2:1105308-1105330 GGTTTCAGGCATCTGCTGCAGGG + Intronic
928058047 2:28078566-28078588 GATTTTAGGCATCCACTGGCAGG + Intronic
928974927 2:37076443-37076465 GATTTCCAGCAACCACTAGAAGG + Intronic
930347864 2:50208145-50208167 AAATTCAGTCTTCCACTGGAGGG - Intronic
930405985 2:50956333-50956355 AATTTCAAGCATCCACTGGGGGG + Intronic
931808572 2:65831743-65831765 TATTTCAGGCAGACACTGTAAGG + Intergenic
932684772 2:73858920-73858942 GATTTCAGGCATCCATTGGGGGG - Intronic
933448208 2:82409783-82409805 GAGTTCTGGCATCCTCTAGATGG - Intergenic
933670604 2:85003946-85003968 AGGTTCAGGCATCCACTGGGTGG - Intronic
934118457 2:88817448-88817470 GGATTCAGGCATCCCCTGGGGGG + Intergenic
935326568 2:101943034-101943056 GAATGCAGGCAGCCTCTGGAAGG + Intergenic
935861745 2:107338599-107338621 TATTTGAGGTATCCAATGGAGGG + Intergenic
937123213 2:119455131-119455153 GTTTTCAGGCCTCTACTGAATGG + Intronic
938058514 2:128234203-128234225 GATGTCAGGCAGGAACTGGAAGG + Intergenic
938066075 2:128282714-128282736 GATTCCAGGCCTCCACCGGTTGG - Intronic
938107365 2:128542325-128542347 AGTTTCAGGCATCCACTGGGGGG + Intergenic
938449791 2:131407462-131407484 GATTTCAGGGACCACCTGGAGGG + Intergenic
938616267 2:133002235-133002257 GGTTTTAGGCATTCACTGGGGGG - Intronic
938673796 2:133610364-133610386 TATTTTAGGAATGCACTGGAAGG + Intergenic
939243414 2:139592243-139592265 GGTTTTAGGCATCCACTGGGGGG + Intergenic
940755005 2:157671903-157671925 GGTTTCAGGCATCCACTGGAGGG - Intergenic
942408134 2:175677135-175677157 GGTTTCAGGCATCCACTGGAGGG - Intergenic
944414263 2:199467515-199467537 GACTTCAGGCATTCAATGAAAGG + Intronic
945528359 2:210918614-210918636 GGTTTCAGGCACCCAATGGGGGG - Intergenic
945665432 2:212735411-212735433 AGTTTCAGGCATTCACTGGGGGG - Intergenic
947448580 2:230183955-230183977 GGTTTCAGGCATCCACTGGAGGG - Intronic
948719405 2:239889228-239889250 GATTCCAGCCATCCAGTGGGTGG - Intergenic
1169187189 20:3628653-3628675 GGTTTCACGCATCCACTGGGAGG + Intronic
1169887708 20:10419517-10419539 AGTTTCAGGCATCCACTGGGTGG - Intronic
1170446975 20:16438510-16438532 AATTTCAGGCAACCACTGGAGGG + Intronic
1170758199 20:19223489-19223511 GGTTTCGGGCATTCACTGGGAGG - Intronic
1172295447 20:33807341-33807363 GTTTTCAGGCATCCACTTGCAGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172453170 20:35043590-35043612 CATTTCAGGTATCCACTGTGAGG - Intronic
1173938577 20:46890545-46890567 GCTTCCAGGCAGCCACTGCAAGG - Intergenic
1175166917 20:57050510-57050532 GACTTTAGGCATCCACTGGGGGG + Intergenic
1175557116 20:59872615-59872637 CATTTCAGGCATCTATTGGGGGG + Intronic
1176378595 21:6100414-6100436 CACTTCAGGCAGCCACTGGAAGG - Intergenic
1178972632 21:37194731-37194753 GACCTCAGGCATTCACTGGGGGG + Intronic
1179744880 21:43437823-43437845 CACTTCAGGCAGCCACTGGAAGG + Intergenic
1179904536 21:44415459-44415481 GAATGCAGGCAGCCTCTGGAAGG + Intronic
1181849279 22:25738433-25738455 AGTTTCAGACATCCACTGGGAGG - Intergenic
1182218227 22:28737152-28737174 GGTTTCAGGCATCCACTGGGGGG - Intronic
1183817989 22:40319831-40319853 GGTTTCAGGCCTCCACTGGGGGG + Intronic
1184868511 22:47218461-47218483 AACTTCAGGCAGCCACTGGGGGG - Intergenic
949183170 3:1159212-1159234 GGTTGTAGGCATCCACTGGGAGG - Intronic
950464313 3:13144318-13144340 GATATCAGGCATCCACGGCTGGG - Intergenic
950647050 3:14383466-14383488 GATTCCAGGGAGCCACTGGGAGG + Intergenic
950820631 3:15754609-15754631 GGTTTCAGGCATCTACTTGGGGG + Intronic
951233092 3:20202227-20202249 GTTTTCAGGCATCCACTAGTAGG - Intergenic
951950758 3:28197995-28198017 GAAATCAGGCATCAACTAGAAGG + Intergenic
952077140 3:29711033-29711055 GATTTCAGGCATCCACTGGGGGG - Intronic
952450279 3:33425685-33425707 GATTCCAGCCTTCCATTGGATGG - Exonic
952863572 3:37835151-37835173 AGTTTCAGGCATCCACTGGTGGG + Intergenic
953450976 3:43005942-43005964 GGTTTCAGGCATCCGCTGGGGGG + Intronic
954593537 3:51804727-51804749 GGTTTCTGGCTTCCTCTGGAAGG + Intergenic
956758416 3:72413650-72413672 AATTTCAGGCATCCACTGGGTGG + Intronic
957217998 3:77346743-77346765 GAATGCAGGCAGCCACTAGAAGG - Intronic
957553348 3:81735097-81735119 AGTTTCAGGCATCCACTTGGGGG + Intronic
957796387 3:85014512-85014534 GGTTTCAGGCATCTCCTGGAGGG + Intronic
958004798 3:87797252-87797274 GGTTTCAGGCATTCACTGGGGGG + Intergenic
958030955 3:88109077-88109099 GGTTTCAAGCATCCAGTGGGAGG + Intronic
958701325 3:97594770-97594792 GATTTCAGACATCAATTTGAGGG + Intronic
958778171 3:98510290-98510312 GATTTCAGGGATCCACACCATGG - Intronic
958879916 3:99658166-99658188 GGTTTCAGGACTCCAGTGGAAGG - Intronic
959617191 3:108361677-108361699 GGTTTCAGGCATCCACTTGGGGG + Intronic
960428038 3:117533153-117533175 GGTTTTAAGCATCCACTGGGGGG - Intergenic
960887490 3:122411066-122411088 AGTTTCAGGCATCTACTGGGGGG + Exonic
960941662 3:122938992-122939014 GAGTTCAGGCCTCCACGGAAAGG - Intronic
962742702 3:138373644-138373666 GATTTCAAGCATCTCCTCGAGGG - Intronic
968565106 4:1307964-1307986 CATTTCAGGCATCAACTTGATGG - Intronic
969489495 4:7491021-7491043 GGTTTCAGGAAGCCACAGGAAGG - Intronic
971084460 4:23255453-23255475 AAATTTAGACATCCACTGGAGGG - Intergenic
971400501 4:26271281-26271303 GATTTCAGGCATCCACTGGAGGG + Intronic
972496144 4:39636712-39636734 GGCTTTAGGCATCCACTGGGGGG - Intronic
972846766 4:43000725-43000747 GGTTTCAGGCATCCACGAGGGGG + Intronic
973831986 4:54770888-54770910 AGATTCAGGCATCCACTGGGGGG + Intergenic
974429255 4:61774853-61774875 TGTTTCAGGCATCCACTGGGGGG + Intronic
975393771 4:73852221-73852243 GGTGTCAGGGACCCACTGGATGG - Intergenic
976907404 4:90257014-90257036 AGTTTCAGGCATCCACTGCGGGG + Intronic
977534652 4:98242929-98242951 GGTTTCAGGCATCCACTGGGGGG + Intergenic
978563545 4:110058472-110058494 GGTTTCTGGCTTCCAGTGGAAGG + Intronic
978577045 4:110198249-110198271 GTTTTCCTGCATCCATTGGATGG + Exonic
979968533 4:127106338-127106360 GGTTTCAGGTATCCCCAGGAAGG + Intergenic
980221948 4:129929252-129929274 GGTTTCAGGCATCCACTAGGGGG + Intergenic
980766371 4:137311114-137311136 GATTTTAGGTATACACTGCAAGG - Intergenic
982151219 4:152459641-152459663 GGTTTCAAGCATCCACTGGGGGG - Intronic
982245681 4:153347968-153347990 GATGTCTGGGAGCCACTGGAGGG + Intronic
983378110 4:166956173-166956195 GGTTTCAGGCATCTACTGGGGGG - Intronic
984745761 4:183215059-183215081 GGCTTCAGGCATCCACTGGGGGG - Intronic
985477411 5:85954-85976 GAGCTCAGGCATCCTGTGGATGG + Intergenic
985860085 5:2464124-2464146 GATTGCAGGAATCCACTAGAAGG + Intergenic
986573741 5:9191722-9191744 GATTTCATGCATCCAGTCCAAGG + Intronic
987284136 5:16439034-16439056 GTTTTCAGGCATCCACCTGTGGG - Intergenic
987679473 5:21116923-21116945 GAGATCAGGCATTCTCTGGAGGG + Intergenic
987792014 5:22580511-22580533 GACTTCAGGAATACTCTGGATGG + Intronic
988475484 5:31581226-31581248 GAATTCAGGCAGCCTCTAGATGG + Intergenic
988685557 5:33522000-33522022 GAGTTCAGAGAACCACTGGAGGG + Intergenic
990168433 5:53020024-53020046 TGTTTTAGGCATCTACTGGAGGG + Intronic
991132668 5:63142348-63142370 AATTTCAGCCATCCACTGGGGGG - Intergenic
991229675 5:64317688-64317710 TGCTTCAGGCATCCACTGGGGGG - Intronic
994228171 5:97279155-97279177 GGTTTCAGGCATCCACTGAGGGG + Intergenic
994410515 5:99402270-99402292 GGTTTCAGGCATCCACTGGGGGG - Intergenic
994483310 5:100362999-100363021 GGTTTCAGGCATCCACTGGGGGG + Intergenic
995424395 5:112004075-112004097 AGTTTTAGGCATCCACTGGGAGG - Intergenic
997960239 5:138315377-138315399 AATTTTAGGCATCCACTGGGGGG + Intronic
998080100 5:139267945-139267967 TCTCTCAGGCATCCACTTGATGG - Intronic
999589893 5:153133412-153133434 GTTTTCAGTCATCCACTGTGTGG - Intergenic
999770564 5:154772493-154772515 AGTTTCAAGCATCTACTGGAGGG - Intronic
999990433 5:157045027-157045049 GGTTTCATGCATCTACTTGAGGG - Intronic
1000144831 5:158444240-158444262 GAGTTCAGGGACCCACTTGAGGG + Intergenic
1000260611 5:159585017-159585039 AAGTTCAGGCCTCCACTGCAGGG - Intergenic
1000883486 5:166723610-166723632 AGTTTCAAGCATCCACTGGGGGG + Intergenic
1001060497 5:168484265-168484287 GGTTTCAGGCATCCACTGAGGGG + Intergenic
1003759214 6:9156328-9156350 GACTTCAGCCATACTCTGGAGGG + Intergenic
1004466765 6:15892635-15892657 TATTTAAGGCATCCTCTGAAGGG - Intergenic
1004663538 6:17730578-17730600 GGTTTCAGGCATCCTCTGGGGGG + Intergenic
1005392872 6:25350937-25350959 AATTTCAGGCATTCATTGGATGG + Intronic
1006169954 6:32087022-32087044 GACCTTAGGCATCCACAGGATGG + Intronic
1006997285 6:38273291-38273313 GGATTCAGTCATCCACTGGGGGG - Intronic
1007602661 6:43092537-43092559 GGTTTTAGGCATCCACTGGGGGG + Intronic
1008746880 6:54682303-54682325 AATTCCAGGCTTCCACTGGGAGG + Intergenic
1009824246 6:68846166-68846188 GATTTAGGGTATCCAGTGGAAGG + Intronic
1012437892 6:99234531-99234553 GATTTCTGCCATCCATTGGGAGG + Intergenic
1012733813 6:102913848-102913870 GATTTCAGGCACCCACTGCATGG + Intergenic
1013489173 6:110628622-110628644 AATTTCAGGCATCCCCTGGGGGG + Intronic
1014291280 6:119561602-119561624 GGTTTTAGGCATCCACTGTGGGG + Intergenic
1014554303 6:122827209-122827231 GGTTTCAGGTATCCACTCGAGGG - Intergenic
1015250010 6:131117489-131117511 AGTTTCAGGCTTCCACTGGGGGG - Intergenic
1015885593 6:137915028-137915050 GATTTGAGACAGCCAATGGAGGG + Intergenic
1020761554 7:12273341-12273363 GGTTTCAGGCATCCACTGGAGGG + Intergenic
1021827288 7:24568050-24568072 GGTTTCAGGTATTCACTGGGGGG - Intergenic
1022022503 7:26414421-26414443 GGTTTCAGGCATCCACTGGAGGG + Intergenic
1023244788 7:38190080-38190102 TGTTTCAGGCATCCCCTGGGGGG - Intronic
1024323795 7:48093168-48093190 GATTTAAGGCAGCAATTGGAGGG + Intronic
1026589253 7:71681276-71681298 GATGTCAGGGAGCCACTGGAAGG + Intronic
1026777081 7:73237169-73237191 GCTTTCAGAAAACCACTGGACGG + Intergenic
1027017927 7:74790539-74790561 GCTTTCAGAAAACCACTGGACGG + Intergenic
1027070096 7:75155390-75155412 GCTTTCAGAAAACCACTGGACGG - Intergenic
1027772684 7:82427068-82427090 AGTTTCAGGCATCCACTGGGGGG + Intronic
1030774806 7:113521145-113521167 AATTTCAGGCATCCACTGTAGGG - Intergenic
1031376306 7:121030790-121030812 AGTTTCAGGCATCCACTTGAGGG + Intronic
1032224610 7:130021239-130021261 GGTTACAGGATTCCACTGGAGGG - Intronic
1032563553 7:132916967-132916989 CATTTCAGGCATCCACAGGGGGG + Intronic
1032620661 7:133527438-133527460 TATTTCAGTCATCCAGTTGATGG + Intronic
1032918771 7:136522242-136522264 AGTTTCAGGCATCCACTGAAGGG - Intergenic
1033022990 7:137746021-137746043 AGTTTCAGGCATCTACTGGGGGG + Intronic
1033094642 7:138419835-138419857 GCTTTCAGGCATACAGGGGATGG - Intergenic
1033214727 7:139484706-139484728 AGTTTCAGGCATTCACTGGGAGG - Intergenic
1036163711 8:6411797-6411819 GGATTCAGGCATCCACTGGGAGG + Intronic
1038026956 8:23599629-23599651 GATTACAGGCATGCACTGCCGGG + Intergenic
1039589694 8:38736017-38736039 GATTTCCTGGAGCCACTGGAGGG - Intronic
1041162819 8:55062192-55062214 GGTTTCAGGCACCCACTGGGGGG + Intergenic
1041591692 8:59594120-59594142 GGTTTCAAGCATCCACTGGAGGG + Intergenic
1041954106 8:63538075-63538097 GGTTTCAGGCATCCACTTGGGGG - Intergenic
1042744330 8:72090311-72090333 AGTTTCAGGCATCCACTGGGGGG - Intronic
1043038461 8:75228811-75228833 GGTTTCAGGCGTCCGCTGGGAGG + Intergenic
1043192291 8:77241010-77241032 CATTTCAGGCATCCATGGGGGGG + Intergenic
1044662436 8:94604721-94604743 TATTTGAGGCATCCAGTGAATGG + Intergenic
1044882024 8:96733090-96733112 GATTTCAGGTATACATTTGATGG + Intronic
1045191141 8:99885379-99885401 GGTTTCAAGAATCCACTAGAGGG + Intronic
1045817376 8:106292552-106292574 GGTTTCAGGTATCCATTGGTGGG + Intronic
1046783653 8:118242616-118242638 GGTTTCAGGCCTCCACTGGGGGG + Intronic
1049140899 8:140953194-140953216 AGTTTCAGGCATCTACTGGGGGG - Intronic
1051067033 9:13116978-13117000 AGTGTCAGGCATCCACTGGCGGG - Intronic
1053658095 9:40240833-40240855 GGTTTCATGCATCCACTTGGGGG - Intronic
1054370217 9:64387108-64387130 GGTTTCATGCATCCACTTGGGGG - Intronic
1054526501 9:66135388-66135410 GGTTTCATGCATCCACTTGGGGG + Intronic
1054677847 9:67876864-67876886 GGTTTCATGCATCCACTTGGGGG - Intronic
1055085155 9:72306197-72306219 GATTTCAGGCATCTAATGGGGGG - Intergenic
1055130850 9:72772590-72772612 GATTTCTGGAATCAAATGGAGGG + Intronic
1055236424 9:74128549-74128571 CATTTCAGGCGTGCACTGGGGGG - Intergenic
1055459361 9:76503355-76503377 GACTTCAGGAATCCTTTGGATGG - Exonic
1056572755 9:87830275-87830297 GTTTTCAGGAATCTGCTGGAAGG - Intergenic
1056596082 9:88008796-88008818 GGTTTCAGACATCCACTGGGGGG + Intergenic
1056755677 9:89380647-89380669 TATTTCAGACATCCACAGGCGGG + Intronic
1057748400 9:97770750-97770772 GGTTTCAGGCATTTGCTGGAAGG - Intergenic
1058250348 9:102687166-102687188 AAGTTCAGGCATTCACTGGGGGG + Intergenic
1059723873 9:116987082-116987104 AGTGTCAGGCATCCACTGGGTGG - Intronic
1060800299 9:126540278-126540300 GGTTCCAGGCATCCACTGGGGGG - Intergenic
1187708060 X:22026857-22026879 GTTTTCATCCATCCATTGGAAGG - Intergenic
1188266824 X:28087091-28087113 GATGTGTGGCATCCTCTGGAGGG + Intergenic
1188527534 X:31102372-31102394 GGTTTCAGGCATCTATTGGGGGG + Intronic
1188904900 X:35780129-35780151 GATATCAGGGATTCTCTGGAGGG + Intergenic
1190036021 X:47024656-47024678 GATTTCAGGCACTGAATGGATGG - Intronic
1190225679 X:48543105-48543127 AGTTTCAGGCATCCACTCGGGGG + Intronic
1190724835 X:53182220-53182242 GATTACAGGCATCCACCGCCAGG + Intergenic
1193539041 X:82748051-82748073 AATTTCAGGCATCCAGTTGGGGG + Intergenic
1194681124 X:96854484-96854506 GGTTTCAGACATCCACTGGAGGG - Intronic
1195335230 X:103847017-103847039 GGTTTCAGGCATCCACTGGGAGG + Intergenic
1196252457 X:113478399-113478421 GATTTCATTCATTCAATGGATGG - Intergenic
1196772663 X:119310299-119310321 GATATCAGGGATTCTCTGGAGGG - Intergenic
1196991034 X:121328956-121328978 GGTTTCAGGCATCCATTGGGGGG - Intergenic
1199006744 X:142708467-142708489 TGTTTCAGGTATCCACTGGGGGG - Intergenic