ID: 971402624

View in Genome Browser
Species Human (GRCh38)
Location 4:26290297-26290319
Sequence TTAGACAGGGTCTCGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3686
Summary {0: 1, 1: 11, 2: 139, 3: 902, 4: 2633}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971402624 Original CRISPR TTAGACAGGGTCTCGTTCTG TGG (reversed) Intronic
Too many off-targets to display for this crispr