ID: 971406489

View in Genome Browser
Species Human (GRCh38)
Location 4:26325299-26325321
Sequence ATGTAGAAGCTGGATAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971406489 Original CRISPR ATGTAGAAGCTGGATAAAGG TGG (reversed) Intronic
903929805 1:26855623-26855645 AGGAAGAAGCTGGCTAGAGGAGG + Exonic
906180834 1:43817497-43817519 ATGAAGAAGAAGGAAAAAGGAGG - Intronic
908443138 1:64175133-64175155 AAGTAGAAACTAGAAAAAGGGGG - Intronic
909306062 1:74078840-74078862 ATGAAGAAGATGGATAGTGGAGG - Intronic
909844274 1:80371530-80371552 ATGTAGACACTGGAGAAAGGTGG - Intergenic
910300933 1:85707198-85707220 ATGAAGAAGCTTGATAATTGAGG + Intronic
911296656 1:96125754-96125776 ATGTAGAAGCTACAGAAAGTTGG + Intergenic
912433570 1:109642962-109642984 ATTTTGAAACTGGATAGAGGTGG + Intergenic
913232727 1:116755202-116755224 GTGAAGAACCTGGATTAAGGTGG + Intronic
922969657 1:229725498-229725520 AGGTAGAAATTGGGTAAAGGGGG - Intergenic
923570694 1:235110987-235111009 AAGTTGAAGCAGGATTAAGGAGG + Exonic
1064633834 10:17344006-17344028 ATGTAGAAGCTGGGTCAGAGCGG + Intronic
1065134036 10:22650874-22650896 ATGTAGAAGCAGGCTAGAGCAGG - Intronic
1065313983 10:24443918-24443940 ATGTCAAAGCTGGATGATGGGGG + Intronic
1067300024 10:44999907-44999929 ATCCAGAAGGTGGATGAAGGTGG + Exonic
1067699197 10:48556400-48556422 ATACAGAAGGAGGATAAAGGAGG - Intronic
1073364383 10:102926335-102926357 AAGTAGGAGCTGGATGAAGCGGG + Intronic
1073645129 10:105293838-105293860 ATGAAGAAGCTGGATATGGTAGG - Intergenic
1077555522 11:3224207-3224229 GTGTGGGAGCTGGATAGAGGAGG + Intergenic
1078767794 11:14316409-14316431 ATGTAAAAACTGTAAAAAGGAGG - Intronic
1079067932 11:17313794-17313816 ATGTAGAACTTGGAAAGAGGAGG - Intronic
1079188082 11:18254944-18254966 ATGTGAGAGCTCGATAAAGGAGG - Intergenic
1080720924 11:34847927-34847949 ATGAGGATGCTGGATGAAGGTGG + Intergenic
1082098186 11:48148393-48148415 ATGTCTAAGCTGAATAAAGCAGG - Intronic
1084712960 11:70855468-70855490 AAGGGGAAGCTGGCTAAAGGGGG - Intronic
1085376924 11:76072163-76072185 ATTTAGAAGTTGAATAGAGGAGG + Intronic
1085994714 11:81897063-81897085 ATCTAGAAACTTAATAAAGGAGG + Intergenic
1086515174 11:87603780-87603802 ATCTAGAAGATGGACACAGGTGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087595628 11:100251241-100251263 ATGTAGATGCTGGCTGAAGCTGG + Intronic
1089553932 11:119304378-119304400 ATGTTCAAGCGGAATAAAGGAGG + Exonic
1090412257 11:126517472-126517494 ATGTGGAAGCTGGCTACAGAGGG + Intronic
1090984046 11:131750233-131750255 GTGTAGATCCTGGACAAAGGTGG - Intronic
1091289581 11:134430262-134430284 AAGTACAAGCTGGAGAAAGACGG - Intergenic
1091911471 12:4233837-4233859 ATCTAGAAGCTGGAAAAAACTGG + Intergenic
1093232039 12:16557196-16557218 ATGTAGAACATGGATAAAATAGG + Intronic
1099319952 12:81133562-81133584 ATGTAGAAGTTGAAAAAAAGTGG - Intronic
1099641348 12:85289731-85289753 CTGTAGATACTGGATAAAGCCGG + Intronic
1101126726 12:101642837-101642859 ATGTGGAGGCTGGAGAAAGGGGG - Intronic
1101873218 12:108582212-108582234 GTGTAGAAGGTGGATAACAGCGG + Intergenic
1104258006 12:127156698-127156720 ATGAGGCAACTGGATAAAGGGGG - Intergenic
1104390963 12:128390351-128390373 CTCTAGAAGCTGGAAAAAGCAGG - Intronic
1105679685 13:22713606-22713628 ATGTAAAAACTGGAGACAGGAGG - Intergenic
1106237363 13:27875052-27875074 ATGTGAAAGCCTGATAAAGGAGG - Intergenic
1108028155 13:46200256-46200278 ATGTTGAAGCTGGCTGAAAGGGG + Intronic
1109280296 13:60348446-60348468 TTGTAGAAACTGGGGAAAGGTGG + Intergenic
1109344860 13:61101944-61101966 ATGTAGAAGTTTTATAAAAGTGG + Intergenic
1109495943 13:63171974-63171996 ATCTAGAAGCTGGAAAAACAAGG - Intergenic
1110222905 13:73091802-73091824 TTGTAAAAGCTGGGTAAAGAGGG - Intergenic
1110522716 13:76499551-76499573 ATTAATAAGCTGGATAAAGAAGG + Intergenic
1111231807 13:85354092-85354114 ATACAGAAGCTGGGTGAAGGAGG + Intergenic
1111321919 13:86642747-86642769 AGGTAGAAGGTGGATAAAAAAGG - Intergenic
1113954619 13:114090866-114090888 AAGTAGAAGGTGGAGAGAGGTGG + Intronic
1114472668 14:22974543-22974565 ATGTAGGGGCTGGAAAAAGGTGG - Intronic
1115050766 14:29059935-29059957 ATGGAGAAGCTTGAAGAAGGAGG + Intergenic
1118063401 14:62165085-62165107 ATTTAGAAGCTGTGTAGAGGAGG + Intergenic
1118604843 14:67495268-67495290 ATGGAGAAGCAAGAAAAAGGAGG - Intronic
1121111323 14:91315123-91315145 AGGTACAAGCAGGAGAAAGGTGG - Intronic
1122356394 14:101125549-101125571 GTGGAGACGCTGGACAAAGGGGG + Intergenic
1122754927 14:103970958-103970980 ATGCAGAATCTGGATACAGAGGG + Intronic
1125515783 15:40320222-40320244 ATGTATAGGCTAGATCAAGGTGG - Intergenic
1125810928 15:42540530-42540552 AGGGACAAGCTGTATAAAGGAGG + Exonic
1126278560 15:46915246-46915268 ATATAAAAGCTGGAAAAAGTAGG - Intergenic
1128007420 15:64256674-64256696 ATGTGGGTGATGGATAAAGGAGG + Intronic
1128285883 15:66436732-66436754 ATGAATTAGCTGGAGAAAGGTGG - Exonic
1131140411 15:89972535-89972557 ATCTAGAAGCTGGACACAGATGG + Intergenic
1131622755 15:94084463-94084485 AAGGAGAAACTGGATAAAGATGG - Intergenic
1131762426 15:95638897-95638919 ATTTAGATGCTGGGTAAGGGGGG - Intergenic
1131972202 15:97904071-97904093 AAGAAGAAACTGAATAAAGGTGG + Intergenic
1135513731 16:23111837-23111859 ATGTTGAAGAATGATAAAGGAGG + Intronic
1136404459 16:30036080-30036102 ATGCAGAAGATGGAAAATGGTGG - Intronic
1139135986 16:64205362-64205384 AGGTAGAGACTGGAAAAAGGAGG - Intergenic
1140274002 16:73492455-73492477 ATGTGGAAGTTGGATCAGGGTGG - Intergenic
1145353983 17:22119439-22119461 AGGGAAGAGCTGGATAAAGGAGG - Intergenic
1147125147 17:38362446-38362468 ATGAATAAGCTGGAGAAAAGTGG + Intronic
1149116639 17:53105234-53105256 CTGTAGAAGCTGGAAAAGGCAGG + Intergenic
1150715899 17:67572449-67572471 CTGAAGAAGCTGGGTAAAGCGGG + Intronic
1151434718 17:74087885-74087907 CTCTAGAAGCTGGAAAAAGCAGG - Intergenic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1156248826 18:35331228-35331250 AGGGAGAAGCTGGATCATGGAGG - Intergenic
1159419966 18:68205653-68205675 ATGTAGAAGCTGGCCAAAGAAGG + Intergenic
1164881023 19:31732930-31732952 AAGGAGGAGGTGGATAAAGGAGG + Intergenic
926202495 2:10812228-10812250 AAGTAGGAGCTGCATAAAGCAGG + Intronic
926415914 2:12649703-12649725 GTGTAGAAGCTGCACAGAGGTGG - Intergenic
927354119 2:22153348-22153370 TTGGAGATGCTGGATGAAGGAGG + Intergenic
928546058 2:32330236-32330258 ATGTTGCAGATGGATAAAGGAGG - Intergenic
928681272 2:33704955-33704977 ATGAAAAAGATGGAAAAAGGAGG + Intergenic
930856114 2:56020387-56020409 ATGGACAAACTGGATAAAAGGGG - Intergenic
931059370 2:58509481-58509503 TTGAAGAATCTGGAAAAAGGTGG + Intergenic
931500274 2:62857055-62857077 TTCTAGAAGCTGGAAAAGGGAGG + Intronic
931650930 2:64468147-64468169 ATTTAGAAGCTGCCTAAAAGAGG - Intergenic
932409868 2:71539290-71539312 AAGTGTAAGCTGGATAGAGGGGG - Intronic
932483362 2:72063785-72063807 TTGAAGAAGATGGATACAGGTGG + Intergenic
932599044 2:73111831-73111853 ACGTAGAAGCTGGCTGCAGGGGG - Intronic
933349572 2:81136692-81136714 ATGTGGAGGCTGGATCAGGGAGG - Intergenic
934688220 2:96336841-96336863 GTTTAGAAGCTGGATAGAGAAGG + Intronic
936249530 2:110857241-110857263 ATGTAGAAGATTGAGAAAAGGGG + Intronic
937332181 2:121038506-121038528 ATGAAGAAGCTGGACAAGGAAGG + Intergenic
937897012 2:126984947-126984969 ATTTGGAAGCTGGACAAATGTGG - Intergenic
942755581 2:179337520-179337542 AGGCAGAAGCTGGATACTGGAGG - Intergenic
943040518 2:182799032-182799054 ATTTGGAAACTGGATACAGGGGG + Intergenic
945230954 2:207589312-207589334 ATGTTGAAGATGGAGAAAGGGGG - Intronic
945670208 2:212793341-212793363 ATGTAGAAACAGGCTAGAGGTGG + Intergenic
946980693 2:225212297-225212319 GTGTAGAAGCTGGAGTAAGCAGG - Intergenic
947534032 2:230929672-230929694 GTGCAGAAGTTGGACAAAGGTGG + Intronic
948458848 2:238119540-238119562 ATGGAGGAGGTGGATGAAGGAGG + Intronic
1169442326 20:5643073-5643095 ATTTAGAGGTTGGATAATGGAGG - Intergenic
1170383177 20:15784742-15784764 ATCTAGATGGTGGATAAATGGGG + Intronic
1173321740 20:41993626-41993648 AAGTAGAAACTGGAAAAAGAGGG + Intergenic
1174093135 20:48065860-48065882 ATCAAGAATCTGGAAAAAGGAGG + Intergenic
1174246619 20:49187196-49187218 AAGAAGAAGCTGGATGATGGCGG + Intronic
1176195630 20:63835395-63835417 TTGTCGAGGCTGGATAGAGGTGG + Intergenic
1177353755 21:19980242-19980264 ATGTAGAATCTCGTTAAATGTGG + Intergenic
1180683446 22:17645824-17645846 ATATGGAAACTGGATAAAGAGGG - Intronic
949234670 3:1793747-1793769 ATGTGGAAGCCCAATAAAGGAGG - Intergenic
949386995 3:3513949-3513971 ATTTTGAAGCTGGAAAAAGTGGG + Intergenic
949870426 3:8583488-8583510 CTGCAGAAGCCTGATAAAGGAGG - Intergenic
950221606 3:11200535-11200557 ATGGAGAAGCTAGACAGAGGAGG - Intronic
950739417 3:15038071-15038093 ATGGCGAAGCTGGATATAGATGG + Exonic
951200327 3:19869284-19869306 ATGTAGAAAGTGGGGAAAGGAGG + Intergenic
951854894 3:27185396-27185418 ATGTGGAAGATGGCTAAGGGAGG + Intronic
952865363 3:37851671-37851693 CTGTAATTGCTGGATAAAGGGGG + Intergenic
953631086 3:44618420-44618442 GTGAAGAAGCTGGATAGTGGTGG + Intronic
955336069 3:58087398-58087420 TTGTTGAAGCTGGGTACAGGAGG + Intronic
957117551 3:76046076-76046098 AAGCAGGAGCTGGATAAAGATGG - Intronic
958446989 3:94227371-94227393 GTGTAAGAGCTAGATAAAGGGGG + Intergenic
961172019 3:124803810-124803832 ACCAAGAAGCCGGATAAAGGTGG + Intronic
961816302 3:129552305-129552327 AAGTAGAAGCTGCCTTAAGGTGG - Intergenic
963625438 3:147666175-147666197 AAGTAGAAGCAAGATAAAGAAGG - Intergenic
964071527 3:152639510-152639532 ATCTAGAAGCTGGAAAGAGGAGG - Intergenic
964637358 3:158872058-158872080 ATGAAGAAGCTAGACAAATGTGG - Intergenic
967204886 3:187110463-187110485 ATGTAGAAGCTAGAGGATGGAGG + Intergenic
968558214 4:1261211-1261233 GTGGGGAAGCTGGATAGAGGTGG + Intergenic
968822115 4:2862096-2862118 AGGTAGAAGTTGGATAGAAGAGG + Intronic
970111928 4:12647263-12647285 ATGTTCAAACTGGATAAAGAAGG + Intergenic
970811130 4:20095345-20095367 AAGTAGAAGCTCCACAAAGGAGG - Intergenic
970913267 4:21304231-21304253 AAGTAGCAGCCGGATAAAGTCGG + Intronic
971406489 4:26325299-26325321 ATGTAGAAGCTGGATAAAGGTGG - Intronic
972273903 4:37539202-37539224 AAGTAGAAGCTGTTAAAAGGAGG + Intronic
977875986 4:102150593-102150615 AAATAGAAGCTGGATTAAAGAGG - Intergenic
978004071 4:103595357-103595379 ACTTACAAGCAGGATAAAGGAGG + Intronic
979552746 4:122009617-122009639 AAGCATAAGCTGGATAAAGGGGG + Intergenic
981124218 4:141087415-141087437 AAGGAGAGGCTGGATAAAGATGG - Intronic
981226947 4:142307944-142307966 ATGTAGCAGCTAGAGACAGGTGG + Intronic
981717772 4:147768652-147768674 TTGTAGAAGCTGAATAAATTTGG + Intronic
981797528 4:148613945-148613967 ATCTAGAAGCTGGATGAATATGG + Intergenic
982658629 4:158179250-158179272 ATGTAGAAACCGGAAAAAGAAGG + Intergenic
983677599 4:170314118-170314140 ATGTAGAAGATGGTAAGAGGTGG + Intergenic
983853525 4:172613049-172613071 ATGTGGAAGCTGAATGAATGTGG - Intronic
983868341 4:172795099-172795121 AGACAGAAGCTGGAGAAAGGCGG + Intronic
984035657 4:174664301-174664323 AGGAAGAACCTGGATAAAGGGGG - Intronic
984150959 4:176129786-176129808 ATGTAGAACCTGGAAACTGGAGG + Intronic
984867485 4:184294556-184294578 AAGTGAAAGCTAGATAAAGGGGG - Intergenic
986788711 5:11139877-11139899 ATGTAGAAGCTGGGAAAGGCAGG - Intronic
987958173 5:24767214-24767236 ATGTCAAAGCTGGTTAAAGGGGG - Intergenic
988497358 5:31756647-31756669 ACATAGGAGCTGGGTAAAGGTGG + Intronic
989420501 5:41234550-41234572 GTGTAGAAGCTGGACAAAAGTGG + Intronic
990255786 5:53967475-53967497 ATTTAGAAACTGGATATGGGAGG + Intronic
990474114 5:56144922-56144944 ATGAAGATGCCTGATAAAGGGGG + Intronic
990732847 5:58828425-58828447 GTGCAGGAGATGGATAAAGGAGG - Intronic
991346131 5:65670433-65670455 ATGTAGGAGCTACCTAAAGGGGG + Intronic
991478082 5:67044808-67044830 AAGTAGAAGCTGGATATAATGGG - Intronic
993651949 5:90532503-90532525 AAGTAGAAGCTGGATAGAAAAGG - Intronic
993754722 5:91714324-91714346 AAGTAGAAGCAAGAGAAAGGTGG + Intergenic
994796217 5:104303631-104303653 AGGTTGAAGCTGGAGCAAGGAGG - Intergenic
994809599 5:104498146-104498168 ATGTAAAAGCTGGGAAGAGGTGG - Intergenic
997780745 5:136655666-136655688 ATGAAAAAGCAGGATAAAGGTGG - Intergenic
998179842 5:139928987-139929009 ATAGAGAACCAGGATAAAGGGGG - Intronic
999106367 5:149074853-149074875 CTCTAGTAGCTGGATAAGGGAGG + Intergenic
999969310 5:156843247-156843269 ATTTAGAAGTTGGAGAAATGAGG + Intergenic
1004234702 6:13863982-13864004 ATGCAAAAGCAAGATAAAGGAGG + Intergenic
1004588917 6:17030131-17030153 ATGTAGTAGATGGATATAAGGGG - Intergenic
1004846774 6:19651845-19651867 CTGTTGAAGCTGCATAAAAGTGG - Intergenic
1005588625 6:27301671-27301693 ATGTAGAAGGAGGATAAATCAGG - Intronic
1005806892 6:29482098-29482120 TTGTATAAGCTGTATAAAAGGGG + Intergenic
1006672138 6:35736208-35736230 ATGCAGATGCTGGAAAAGGGTGG + Intergenic
1008147728 6:47911912-47911934 ATTTAGAAGGTGGATAGTGGAGG + Intronic
1008273237 6:49514460-49514482 TTGTAGAAGCTGGACAAAGTTGG - Intronic
1011970657 6:93218943-93218965 TTCTAGAAGATGGAAAAAGGGGG - Intergenic
1012018803 6:93889600-93889622 ATTTAGAAACTGGATATAGCTGG + Intergenic
1012043831 6:94243622-94243644 ATGTAGAAGATAAATAAAGGTGG - Intergenic
1012814888 6:104010727-104010749 CTGTAGAAGCTGGAAACAGCAGG + Intergenic
1013252957 6:108352924-108352946 ATGTAGAAACTAGATACAGAGGG + Intronic
1013872683 6:114785812-114785834 ATGTAGAAGCTGGACATGGCAGG - Intergenic
1015960429 6:138643320-138643342 ATGGAGGATGTGGATAAAGGAGG - Intronic
1016311453 6:142738142-142738164 GTGTAGGAACTTGATAAAGGAGG - Intergenic
1018229225 6:161659834-161659856 ATGTAGAACCTGAATAAGTGTGG - Intronic
1018518767 6:164619030-164619052 GTGTAGAAGCTGAACAAAAGAGG - Intergenic
1019160051 6:170063495-170063517 ATGTAGAAAGGGGATAAAAGGGG + Intergenic
1021097797 7:16552904-16552926 ATGTAGTAGCTGTATAATCGTGG + Intronic
1022748431 7:33197472-33197494 ATGTAGAGACTGGAAAAGGGTGG - Intronic
1022756079 7:33292009-33292031 ATGAAGAAACTGAATAAGGGTGG - Intronic
1023477082 7:40592488-40592510 ATGATGAAGGTGAATAAAGGAGG + Intronic
1023867466 7:44245020-44245042 ATGGAGAAGTTGGACAGAGGAGG + Intronic
1027719729 7:81724975-81724997 GTGTAGCTGCTGGATAATGGTGG - Intronic
1027724056 7:81780870-81780892 ATTTTGAAGATGGAGAAAGGGGG + Intergenic
1027773488 7:82435700-82435722 ATGTAGAAGATGGATTAAGGCGG - Intronic
1029250346 7:99232115-99232137 ATGTAGAGGGTGGAGACAGGGGG + Intergenic
1033286218 7:140042717-140042739 ATGTTGGTTCTGGATAAAGGAGG + Intronic
1033980857 7:147163811-147163833 ATGTAGAAAATGGGAAAAGGGGG - Intronic
1037240417 8:16771052-16771074 ATGTGAAAGCTGGATAATTGAGG + Intergenic
1037768687 8:21786816-21786838 AGGTAGGAGCTGGTTACAGGAGG - Intronic
1038964080 8:32551833-32551855 ATGAAGAGGCTGGATATGGGAGG - Intronic
1040068005 8:43164243-43164265 TTGTTGAAGCTGGATGATGGAGG + Intronic
1040382958 8:46890900-46890922 ATGTAGAACCTGCCTAAAGAGGG - Intergenic
1040699281 8:50041581-50041603 TTGTACAAACTGGATAAAAGAGG - Intronic
1041313027 8:56535847-56535869 GTGTACAAGCAGGATAAATGAGG - Intergenic
1042440003 8:68814488-68814510 AGGTAGATGCTGGATACAGCTGG - Intronic
1045340862 8:101253163-101253185 TTGGAGAAGTTGGATATAGGTGG - Intergenic
1045771131 8:105741943-105741965 GTGTTGAAGCTGGATAAACAGGG + Intronic
1046857819 8:119054135-119054157 ATGGATAGGCTGGACAAAGGAGG + Intronic
1046899275 8:119506417-119506439 ATGAAGTTGCTGGCTAAAGGTGG - Intergenic
1048517004 8:135120381-135120403 ATGTAGAAGGGGGTCAAAGGTGG + Intergenic
1051399468 9:16664059-16664081 TTCGAGAAGCAGGATAAAGGTGG - Intronic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052609193 9:30748518-30748540 ATTTAGAAGTTGGAAAAAGTAGG + Intergenic
1055844401 9:80544060-80544082 CTCTAGAAGCTGGAAAAAGCAGG + Intergenic
1055928963 9:81540203-81540225 ATGTAGAAGGTGTCTAGAGGAGG - Intergenic
1056081816 9:83102824-83102846 AGGTAAGAGCTAGATAAAGGAGG + Intergenic
1056737283 9:89220510-89220532 ATGGAGAAGTTGGATAAGAGTGG - Intergenic
1058454565 9:105127149-105127171 AAGTAGATGCTGGATAGAGTGGG - Intergenic
1058555762 9:106165204-106165226 ATCTAGAAGATAGATAAAGAAGG + Intergenic
1061693291 9:132353184-132353206 ATGTGGAAGCTGGATCATCGCGG - Intronic
1186532963 X:10316025-10316047 GTGTATAAGTTGGATAAGGGAGG + Intergenic
1186871264 X:13776182-13776204 ATTTAGAAGCTGGAGGGAGGAGG + Intronic
1187550452 X:20297705-20297727 ATGTAGAAGCTGGAGTGAGTTGG + Intergenic
1187789125 X:22929457-22929479 AGGTAGTTGCTGGAAAAAGGAGG - Intergenic
1189775570 X:44467668-44467690 AAGTAGAAGGTGAAGAAAGGTGG + Intergenic
1190850897 X:54240507-54240529 ATGTAGTAACTGGATCAAGATGG + Intronic
1194291649 X:92080160-92080182 CTGTAGAAGCTAGAAAAGGGAGG + Intronic
1194997629 X:100609091-100609113 ATGTAGACACTGGGTAAAGAAGG - Intergenic
1196493648 X:116297774-116297796 CAGTAGAAGCTGGATATATGTGG + Intergenic
1198527852 X:137520120-137520142 ATGTAGAAAATAGATCAAGGCGG + Intergenic
1199848735 X:151710307-151710329 ATGGAAAAGCTGGACAGAGGCGG - Intergenic
1200609166 Y:5304739-5304761 CTGTAGAAGCTAGAAAAGGGAGG + Intronic