ID: 971406501

View in Genome Browser
Species Human (GRCh38)
Location 4:26325407-26325429
Sequence AAGAGAGGCAACAGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 505}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971406494_971406501 -4 Left 971406494 4:26325388-26325410 CCCCCTAGCAGCGTTCATTAAGA 0: 1
1: 0
2: 0
3: 6
4: 38
Right 971406501 4:26325407-26325429 AAGAGAGGCAACAGAGTGGAGGG 0: 1
1: 0
2: 7
3: 48
4: 505
971406493_971406501 9 Left 971406493 4:26325375-26325397 CCTTTCAATGGCTCCCCCTAGCA 0: 1
1: 0
2: 2
3: 20
4: 201
Right 971406501 4:26325407-26325429 AAGAGAGGCAACAGAGTGGAGGG 0: 1
1: 0
2: 7
3: 48
4: 505
971406495_971406501 -5 Left 971406495 4:26325389-26325411 CCCCTAGCAGCGTTCATTAAGAG 0: 1
1: 0
2: 1
3: 0
4: 28
Right 971406501 4:26325407-26325429 AAGAGAGGCAACAGAGTGGAGGG 0: 1
1: 0
2: 7
3: 48
4: 505
971406496_971406501 -6 Left 971406496 4:26325390-26325412 CCCTAGCAGCGTTCATTAAGAGA 0: 1
1: 0
2: 0
3: 11
4: 53
Right 971406501 4:26325407-26325429 AAGAGAGGCAACAGAGTGGAGGG 0: 1
1: 0
2: 7
3: 48
4: 505
971406497_971406501 -7 Left 971406497 4:26325391-26325413 CCTAGCAGCGTTCATTAAGAGAG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 971406501 4:26325407-26325429 AAGAGAGGCAACAGAGTGGAGGG 0: 1
1: 0
2: 7
3: 48
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971406501 Original CRISPR AAGAGAGGCAACAGAGTGGA GGG Intronic
900404990 1:2489008-2489030 TTGAAAAGCAACAGAGTGGATGG - Intronic
901586249 1:10295745-10295767 GAGAGAAGCAACAGCGGGGAAGG + Exonic
901977183 1:13004426-13004448 AAAAGAGGCAACAGAGGGGAGGG + Intronic
902004903 1:13224508-13224530 AAAAGAGGCAACAGAGGGGAGGG - Intergenic
902024122 1:13370244-13370266 AAAAGAGGCAACAGAGGGGAGGG - Intronic
902209155 1:14892405-14892427 AAGAGAGACAGCAGGGGGGAGGG - Intronic
902528892 1:17077659-17077681 ATGAGTGGCCACTGAGTGGAGGG + Intronic
902927872 1:19709042-19709064 GAGAGAGGCCACAGAAGGGAGGG + Intronic
903375927 1:22865982-22866004 TAGAGAGAGAACAGGGTGGAGGG - Intronic
905956272 1:41999750-41999772 AAGAGAGGGAACATAAAGGAAGG + Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907380412 1:54082680-54082702 TACAGAGGCAAAAGAGTGGGAGG + Intronic
907415494 1:54311335-54311357 GAGAGAGGCAGCAGTGTGGAGGG + Intronic
907684107 1:56593117-56593139 AAGAGAGGTAATAGAAAGGAAGG - Intronic
909569141 1:77088176-77088198 AAGGGAGGCAAGAGAGTCTATGG + Intergenic
909881760 1:80888817-80888839 AAGAGAGGGAATGGAGAGGATGG + Intergenic
910366429 1:86470246-86470268 GGGATAGGGAACAGAGTGGAGGG + Intronic
911169547 1:94756625-94756647 TAGGGAGGCAGCAGAGTGGAGGG - Intergenic
911318658 1:96385587-96385609 AAGACAAGCCACAGACTGGAAGG + Intergenic
911690935 1:100833865-100833887 AAGAAAGACAACAGAGTTGTTGG - Intergenic
912228478 1:107763813-107763835 CAGAGAGGCAAAACAGTGAAGGG + Intronic
913300076 1:117360952-117360974 AAGAGAGGGAAGAGAAAGGAAGG - Intergenic
915078164 1:153329939-153329961 AAGAGAAGCAACAGGGTGTCTGG - Intergenic
915163271 1:153934043-153934065 AAGACCAGAAACAGAGTGGAGGG - Intronic
915880128 1:159661115-159661137 AAGAAAAGCCAAAGAGTGGATGG - Intergenic
916676815 1:167070911-167070933 AAGAGAGGAAACACAAAGGAAGG + Intronic
916690730 1:167187596-167187618 AAGATAGGCAACAGAGTTTATGG + Intergenic
916818125 1:168372834-168372856 AAGAGAGGCAACATCTTGGGTGG + Intergenic
917140306 1:171828523-171828545 GAGAGAAGCAAGAGGGTGGAGGG + Intergenic
917201847 1:172525526-172525548 AGGAGAGGCAAGAGACAGGAGGG - Intergenic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
918163857 1:181925754-181925776 ATGAGAGGCAACAGAGAGGTGGG - Intergenic
918716685 1:187797740-187797762 AAGAGAAAAAAGAGAGTGGAAGG - Intergenic
919335670 1:196229429-196229451 AGGAGAGGGAAAAGAGTCGAGGG - Intronic
920051760 1:203168590-203168612 CACAGAGGTAACAGAGTGGGTGG + Intronic
920493373 1:206436689-206436711 AAGAGAGGCAAAACAAGGGAAGG + Intronic
920590496 1:207214057-207214079 AAGAGAGGAAACTGGGTGAAGGG - Intergenic
920617026 1:207503595-207503617 AAGGGAGGCAAGAGGGTGAAAGG - Intronic
920988419 1:210912590-210912612 AAGAGAGGAAACACAGGGGCAGG + Intronic
921034690 1:211365494-211365516 AAGTGAGGCAACAGAATTGCTGG + Intronic
921341117 1:214135828-214135850 AAGACAGGCAACAGACTCCAGGG + Intergenic
921429567 1:215049426-215049448 AAGACAAGCCACAGACTGGAAGG - Intronic
921721782 1:218480421-218480443 GAGAGAGGGGACAGAGTTGAGGG - Intergenic
922504877 1:226120702-226120724 AAGAGAGGAAACAGGTAGGAAGG + Intergenic
1063516521 10:6701548-6701570 GAGAGAGAGAACAGAGTGGCAGG + Intergenic
1063610399 10:7557264-7557286 AAGAGGGGATCCAGAGTGGAGGG + Intergenic
1064306372 10:14170785-14170807 AAGAGAGGTAGGGGAGTGGAAGG - Intronic
1064800102 10:19060720-19060742 GAGAGAGGTCACAGAGTAGAAGG + Intronic
1064951311 10:20854218-20854240 AAAAATGGCAATAGAGTGGAGGG + Intronic
1065818896 10:29507067-29507089 CAGAGAGGCTACAGTGAGGATGG + Intronic
1065932302 10:30490623-30490645 AAGAGAGGAAGAAGTGTGGAGGG + Intergenic
1066137070 10:32459251-32459273 AAGAAAAGCAACTAAGTGGAGGG - Intronic
1066785240 10:38996064-38996086 AAGAGATCCAAGAGAGTAGATGG + Intergenic
1067131647 10:43570673-43570695 AAAAGAGGTAACACATTGGAGGG - Intronic
1067241013 10:44493588-44493610 AAGAGAAGGAAGAGAGAGGAAGG - Intergenic
1067292885 10:44957436-44957458 AAGAGAGGAAAGAGAGAGGGAGG - Intergenic
1067853477 10:49769877-49769899 AAGGGAGGAAAAAGAGAGGAAGG + Intergenic
1068520848 10:58075821-58075843 ATGAGAGGAAACAGGGTGAAAGG + Intergenic
1069011537 10:63379008-63379030 AAGGGAGGGAAGAGAGTGAATGG - Intronic
1069247322 10:66222158-66222180 AAGAGAGTTAACAGAATTGATGG - Intronic
1070337570 10:75468796-75468818 AAGAGAGGCCACAGGCTGGACGG - Intronic
1070350625 10:75588705-75588727 AAGATAGGGAACAGAATGGGAGG - Intronic
1070791273 10:79190918-79190940 AACAGAGGCCAGAGAGGGGAGGG - Intronic
1070897892 10:80000777-80000799 AAGCGAGGTTACAGAGTAGATGG + Intergenic
1071590682 10:86870116-86870138 AAGAGAGTGAAAAGAGGGGAGGG - Intronic
1072424841 10:95321197-95321219 AACTCTGGCAACAGAGTGGAGGG - Intronic
1072766808 10:98101294-98101316 AAGATAGCCAACAGGGTGGTAGG - Intergenic
1074342616 10:112648250-112648272 AAGAGAGAGAACAAAATGGAAGG - Intronic
1074645280 10:115443340-115443362 AAGAGAGCCCACAGACTGAAAGG - Intronic
1075425000 10:122334847-122334869 AAGAGAAACAACAAAGTGAAGGG - Intronic
1076645542 10:131951936-131951958 CAGAGTGGCAACACAGTGCAGGG + Intronic
1077446929 11:2599120-2599142 AACATAGGTAACAGAGAGGAGGG - Intronic
1077460066 11:2704622-2704644 AAGAGAGGCAGCAGGGTGAGGGG + Intronic
1077977629 11:7264442-7264464 AAGAGTAGCAAAAGAGTTGAGGG + Intronic
1078472876 11:11605578-11605600 AAGAAAGGAAACAGAGTGCTTGG - Intronic
1081130553 11:39373747-39373769 AAGAAATGCAACAGTGTGGCTGG - Intergenic
1081989188 11:47328540-47328562 GTGAGAGGCCACAGAGGGGAAGG + Intronic
1082971798 11:59030520-59030542 GAGAGAGGCAACAGTGAGAAAGG - Intronic
1083166669 11:60892710-60892732 AAGAGGGGCAAGAGACAGGAGGG - Intronic
1083865904 11:65452729-65452751 AAGAGTGGGAACAGAGCGGGAGG - Intergenic
1083871400 11:65490502-65490524 GGGAGAGGCAGCAGAGGGGAGGG - Intergenic
1084879656 11:72161490-72161512 AAAACAAGCAACAGACTGGAAGG + Intergenic
1087008556 11:93492515-93492537 AAGAAAGACAAAAGAGTGTAAGG + Intronic
1087619763 11:100528256-100528278 AAGAGTGACATCGGAGTGGAGGG + Intergenic
1088501602 11:110489011-110489033 AAGAGAAGAAACACAGTGTATGG + Intergenic
1089050485 11:115540823-115540845 AGGCGAGCCAACAGAATGGAGGG - Intergenic
1089860258 11:121583640-121583662 AAGAGAGGCCACAGAGAGCCAGG + Intronic
1089895552 11:121927004-121927026 AAGAGGGGCAAGAGACAGGAGGG + Intergenic
1090643147 11:128746364-128746386 AGGAGAGGAAAGAGTGTGGATGG - Intronic
1090921485 11:131209955-131209977 AAGTCAGGCAACAGATTAGAGGG + Intergenic
1090975166 11:131673749-131673771 AGGAGAGCCGAGAGAGTGGAGGG - Intronic
1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG + Intronic
1091240324 11:134047686-134047708 CAGAGAGCCAGCAGAGAGGAAGG + Intergenic
1091583465 12:1802499-1802521 ATGAGAGGTGGCAGAGTGGAGGG - Intronic
1091931842 12:4402704-4402726 AAGAGGGGCAGCAGAGTCCAGGG + Intergenic
1092090230 12:5798098-5798120 AAAACAGGCGACAGAGTGGGTGG + Intronic
1092204138 12:6605624-6605646 AAGAGGGGCAAAAGAAGGGAGGG - Intronic
1092238026 12:6821922-6821944 AAGGGAGGCAACACAGGGGACGG - Intronic
1092503286 12:9068597-9068619 AAGAGGGGCATCAGACTTGATGG + Intronic
1092701155 12:11232256-11232278 AAGAGTGGACACAGACTGGAAGG + Intergenic
1092996693 12:13957729-13957751 AAGGGAGGCAAGAGAGATGAGGG - Intronic
1095492891 12:42754176-42754198 AAGACAAGCCACAGAATGGAAGG + Intergenic
1096672646 12:53209429-53209451 AAGAGTGGGAACAGAGAGGGTGG + Intergenic
1097501733 12:60411580-60411602 AAGTCAGGCAAGAGAGGGGAGGG - Intergenic
1097767173 12:63539400-63539422 AACAGAACCAACAGGGTGGATGG + Intergenic
1097783520 12:63734346-63734368 AACAGAACCAACAGGGTGGATGG + Intergenic
1098055853 12:66504297-66504319 ACAAGAGGCAACAAACTGGAGGG - Intronic
1098118726 12:67211254-67211276 AAGAGAGGCAGAAGTATGGAAGG + Intergenic
1098470334 12:70836068-70836090 AAGACAGGCTACAGACAGGATGG - Intronic
1098676690 12:73298085-73298107 AAGATAGGTATCAGAGAGGAGGG - Intergenic
1099679542 12:85807303-85807325 ATAATAGGCAACAGAGGGGATGG + Intronic
1100017756 12:90032106-90032128 AAGAGAAGCCACAGACTGGGAGG - Intergenic
1100158260 12:91827374-91827396 AAGATAGGCAAGAGAAAGGATGG - Intergenic
1104064706 12:125297185-125297207 CAGTGAGACAACAGGGTGGATGG + Intronic
1104498945 12:129266426-129266448 AAGAAAGGGAAGAGAGGGGAAGG - Intronic
1106051486 13:26194261-26194283 GGGAGAGGCAAGAGAGTTGAGGG + Intronic
1106086380 13:26546041-26546063 AAAAGAAGCAAAAGAGTGAAAGG - Intergenic
1106497873 13:30297208-30297230 AAGAGAGGAAAAAGAGAAGAAGG + Intronic
1106602122 13:31197123-31197145 GAGAGAGGCAGCAGGCTGGAGGG + Intergenic
1106665034 13:31842728-31842750 AACAGAGGCATGAGAGTAGAAGG - Intergenic
1106935481 13:34714146-34714168 TAAAGAGGCAACATAATGGAAGG - Intergenic
1107595631 13:41960760-41960782 CAGCGAAGCAACAGAGAGGAGGG + Intronic
1107795529 13:44047401-44047423 GAGAGAGGCTATGGAGTGGAAGG + Intergenic
1111289617 13:86147849-86147871 AAGACAGCCTACAGAATGGAAGG + Intergenic
1112164886 13:96907538-96907560 TAGAGTTGCAGCAGAGTGGACGG + Intergenic
1112298915 13:98212698-98212720 TACAGAGGCAACAGAGAGTAGGG - Intronic
1112379372 13:98873894-98873916 GAGAGAGGCAGTAGAGTAGAGGG - Intronic
1112950404 13:104988716-104988738 AATAAAGGCAGAAGAGTGGAAGG + Intergenic
1113159958 13:107368634-107368656 AAGAGAAGACACAGAGAGGAGGG - Intronic
1113465562 13:110510328-110510350 GAGAGAGGCCACCGAGGGGAGGG - Intronic
1114115278 14:19615765-19615787 AAGAGAGACAAGAAAGTGGGGGG - Intergenic
1114251728 14:20967705-20967727 CTGAGAGGCAAAAGAGTAGAAGG + Intergenic
1115734371 14:36308760-36308782 CAGAAAGGCCACAGTGTGGAGGG - Intronic
1115803087 14:37018292-37018314 AAGATAGGTAACAGTGTTGAGGG - Intronic
1116097769 14:40393694-40393716 GAGAGAGTCAATAGTGTGGAAGG - Intergenic
1116481663 14:45398312-45398334 GAGAGAGCCCACAGAGTGGGAGG + Intergenic
1117097893 14:52315692-52315714 AAGATAGGCAACAGCGAGAAAGG - Intronic
1117518166 14:56523308-56523330 AAGATATGCAACAGGTTGGAAGG + Intronic
1117519042 14:56531844-56531866 CACATAGGCAGCAGAGTGGAGGG - Intronic
1118031202 14:61819889-61819911 AAGAGATGGAACAGAGTTGCTGG + Intergenic
1118110710 14:62715797-62715819 TAGAGAGGAAAAAGAGAGGAAGG + Intronic
1118471044 14:66075433-66075455 GACAGAGGCAGCACAGTGGACGG + Intergenic
1120729678 14:87989028-87989050 AAGAGTGGCATCAGAATGCATGG + Intronic
1121148283 14:91605725-91605747 GAGAGTGGTAACAGAGAGGAGGG - Intronic
1122506269 14:102233775-102233797 AAGAGGGGCTGCAGACTGGAAGG + Exonic
1122512811 14:102283778-102283800 AAGGGAGGGCACAGACTGGAAGG - Intronic
1202942693 14_KI270725v1_random:168892-168914 AAGTGTGGCAGCAGAGTTGATGG + Intergenic
1123505037 15:20933511-20933533 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1123562282 15:21507205-21507227 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1123598527 15:21944492-21944514 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1124109905 15:26775428-26775450 AAGAGAGGGAGCAGATAGGAGGG - Intronic
1125923114 15:43538456-43538478 AAAACAGGCAACAGAGAGAAGGG + Intronic
1126188658 15:45855808-45855830 CAGAGAGGCAACCTAGTGAATGG + Intergenic
1126290757 15:47074867-47074889 AAGGGTGGCAGCAGAGTTGATGG - Intergenic
1127806886 15:62529504-62529526 AAGAGAGGCAAGGGAGGGGCAGG - Intronic
1127964648 15:63914521-63914543 AAGGGAGGCACAAAAGTGGATGG + Intronic
1128149505 15:65354406-65354428 AAAAGGGGCAACAGAGTTGTAGG - Intronic
1128788769 15:70417409-70417431 CAAAGAGCCGACAGAGTGGAGGG + Intergenic
1128998621 15:72315590-72315612 AGGAGAGGCATCAGTGTTGAGGG - Intronic
1129090593 15:73146028-73146050 AAGCCAGGCAAGGGAGTGGAAGG - Intronic
1129194581 15:73956257-73956279 AGGAGAGGAAACAGAATGGGTGG - Intergenic
1129712537 15:77827817-77827839 GAGAGAAGCCACAGAGTTGAGGG - Intergenic
1130147827 15:81288050-81288072 CAGAGAGGCCACAGAGGTGAGGG + Intronic
1130959171 15:88648423-88648445 TAGAGTGGAAACACAGTGGAAGG + Intronic
1130995348 15:88900413-88900435 AGGAGAGGCCACAGCCTGGAGGG + Intronic
1131158115 15:90087404-90087426 AAGAAAGGCCACAGAGTACATGG + Intronic
1131166556 15:90145850-90145872 CAGAGAGGCAAGAGAGGGGATGG + Intergenic
1131670087 15:94610609-94610631 CAAATAGGAAACAGAGTGGAGGG - Intergenic
1131685926 15:94767501-94767523 AAGAGAGACAGGAGAGGGGAGGG + Intergenic
1131784488 15:95897177-95897199 AAGAGAGGGAAGAGAGAGGCAGG - Intergenic
1202970627 15_KI270727v1_random:234347-234369 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1132595576 16:747730-747752 GAGCCAGGCAACAGAGTGCAGGG + Intronic
1132770418 16:1559084-1559106 CAGAGAGGCGATGGAGTGGAGGG + Intronic
1133325303 16:4938393-4938415 AAGAAAGGAAAGAGAGAGGAAGG - Intronic
1133686900 16:8173917-8173939 TTGAGAGGCACCAGTGTGGAGGG - Intergenic
1133837101 16:9377192-9377214 CAGAGAGGCAGCAGAGTGGATGG - Intergenic
1133866238 16:9646196-9646218 AATAAAAGCAACTGAGTGGATGG - Intergenic
1134120647 16:11581945-11581967 AAGAGAGGCTAGAGAGAGGTTGG + Intronic
1134319971 16:13153927-13153949 AATAGAGGCAACAGATCTGAGGG + Intronic
1134754093 16:16650826-16650848 AAGAGAGGGAAGAGAAGGGAAGG - Intergenic
1134991968 16:18708223-18708245 AAGAGAGGGAAGAGAAGGGAAGG + Intergenic
1135515272 16:23126971-23126993 GAGAAAGGCAATAGAGTGGAAGG + Intronic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1135743330 16:24995443-24995465 AAGAGAGGGAAGAGAGAGCAGGG + Intronic
1135752883 16:25070908-25070930 AAGAGAGGGAAGAGAGAGCAGGG - Intergenic
1136375230 16:29861447-29861469 GAGAAAGGCATGAGAGTGGAGGG + Intronic
1137055170 16:35742273-35742295 AGGAGGGGCTACAAAGTGGAAGG + Intergenic
1139758672 16:69166419-69166441 CAAAGAGGCAAGAGAGTGGGAGG - Intronic
1139853923 16:69965883-69965905 AAGGGAGGCTGCAGAGGGGAGGG - Intergenic
1139882901 16:70188796-70188818 AAGGGAGGCTGCAGAGGGGAGGG - Intergenic
1140369608 16:74406723-74406745 AAGGGAGGCTGCAGAGGGGAGGG + Intergenic
1140738172 16:77917697-77917719 AGGCAAGGCAGCAGAGTGGAGGG - Intronic
1141209494 16:81963807-81963829 AAGACAAGCCACAGAGTAGAGGG + Intergenic
1142008249 16:87700604-87700626 GAGGGAGGAAACAGGGTGGAGGG + Intronic
1142355143 16:89598340-89598362 AAAATAGGCCCCAGAGTGGATGG - Intergenic
1142858817 17:2749113-2749135 AAGCGAGGTAGCAGAGAGGAGGG + Intergenic
1142993296 17:3746235-3746257 AAGAGAGACAACAAAGAGAATGG + Intronic
1143253689 17:5540525-5540547 AAGAGAGGGAACAGGGAGAATGG + Intronic
1143302749 17:5922883-5922905 GAGAGAGGTGACAGAGAGGAAGG - Intronic
1143467319 17:7146157-7146179 AAGAGAGGGAGCAGAGAGGAGGG + Intergenic
1143706403 17:8700624-8700646 AATAGAGGCAACAGATATGAGGG - Intergenic
1143766555 17:9141526-9141548 AGAAGATGCAGCAGAGTGGACGG + Intronic
1144442103 17:15292809-15292831 AGCGGAGGCAGCAGAGTGGAAGG - Intergenic
1145751941 17:27361508-27361530 AGGAGAGGCAGCAGGATGGAGGG - Intergenic
1146104630 17:30022612-30022634 AAGTAAGGAAACAAAGTGGAAGG - Intronic
1146241203 17:31228612-31228634 AAGAGAGGCAAGAAAGTGGGTGG - Intronic
1146553156 17:33799328-33799350 AAGAGAGGAAACAGAGAGGGAGG - Intronic
1147332535 17:39707226-39707248 AAGAGAGGAAACAGAAGGGCAGG - Intronic
1148512511 17:48184532-48184554 GAGAGTGGCAACAGAGGGGAGGG + Intronic
1148945424 17:51259150-51259172 CAGAGAGGCTGCAGAGGGGACGG + Exonic
1150482556 17:65521783-65521805 CAGAGAGACAACTGTGTGGAGGG + Intergenic
1151055807 17:71030258-71030280 AAGAGAGGAAACAGCATGGGAGG + Intergenic
1151058818 17:71066795-71066817 ATGAGAGGCAGCAGAGTGTAGGG + Intergenic
1151105086 17:71603803-71603825 AACAGAGCCACCAGAGTAGATGG - Intergenic
1151159133 17:72150217-72150239 ACAAGAGACAACGGAGTGGAAGG + Intergenic
1151209052 17:72530333-72530355 AAGAGATGCACCAGATTAGATGG + Intergenic
1151615260 17:75205905-75205927 AAAAGTGGCAACTGAGTCGAGGG - Intronic
1151842268 17:76626984-76627006 AAGAGGGGCAAGAGAGGGGCTGG + Intronic
1152070087 17:78130054-78130076 TAGAGAGGGAGCAGAGAGGAAGG + Intronic
1152943861 17:83187841-83187863 AAGAAAGCCAACACAGTGGCTGG + Intergenic
1154021565 18:10668165-10668187 AAGAGAGGGCCCAGAGTGGGCGG + Intronic
1154334315 18:13453768-13453790 ATGAGGGGCAACAGAGGGAAGGG - Intronic
1155417608 18:25616788-25616810 GAGAGAGTCAGCTGAGTGGAAGG + Intergenic
1155509087 18:26559411-26559433 AAGAGAAGAAACAGAGTGCTGGG + Intronic
1156086614 18:33413718-33413740 AGGAGAGGCAACTGAGAGGTTGG + Intronic
1156375866 18:36514911-36514933 AGGGGAGGCAACAGAGAGAAAGG + Intronic
1156586124 18:38433212-38433234 TTGAGAGGCATTAGAGTGGAGGG - Intergenic
1157391993 18:47310689-47310711 AACAGCGGTAACACAGTGGAGGG - Intergenic
1158027314 18:52915729-52915751 AAGAGAGGCAGAAAAGAGGAAGG + Intronic
1158300788 18:56050130-56050152 GAGAGAGGCATCAGAGTGACAGG - Intergenic
1158969302 18:62651477-62651499 AAGAGAGGAAACAGAGAATAGGG + Intergenic
1159029411 18:63215616-63215638 AAGAGAGGAATTAGAGTGGAAGG + Intronic
1160111448 18:76035956-76035978 AAGAGAGGCAACAATGAGTAAGG - Intergenic
1161113824 19:2485619-2485641 AAGAGAGGCATCTGTGTGTATGG + Intergenic
1161428780 19:4218688-4218710 AAGAAAGGAAAGAGAGAGGAAGG - Intronic
1162395882 19:10417872-10417894 AGGAGAGGGAGCAGAGTGGGAGG + Intronic
1163885683 19:19962741-19962763 AAGAGAGGCATTATAGTGTATGG + Intergenic
1164053011 19:21599068-21599090 AAGAAAGGCAATAGAGGGAAAGG + Intergenic
1165375187 19:35436972-35436994 AGGAGAGGCAGCAGAGTGTCTGG - Intergenic
1166142897 19:40814710-40814732 AAGAAAGGGAAAAGAGGGGAGGG - Intronic
1166169750 19:41019441-41019463 AAGAGCGACAGCAGAATGGAAGG + Intergenic
1166184661 19:41132102-41132124 AAGAAAGGGAAAAGAGGGGAGGG + Intergenic
1166661538 19:44650381-44650403 AAGGGAGTCAACAGAGTGTCAGG - Intronic
1167163834 19:47784598-47784620 AAGAGAGGCATCAGGATGGGTGG + Exonic
1167169441 19:47821602-47821624 GAGAGAGGCATCAAAGAGGAAGG - Intronic
1167292133 19:48630191-48630213 AATGGAGGCACCGGAGTGGATGG - Exonic
1167436662 19:49482454-49482476 AACTGAGGCAGCAGAGTGAAGGG - Intronic
1167487914 19:49773939-49773961 CAGAGAGGGAACAGGGTAGATGG + Intronic
1168028853 19:53663906-53663928 AAGAAAAGAAACAGAGTAGATGG + Intergenic
924990005 2:306108-306130 AAGAGAGTAAACAGAGTGGAAGG - Intergenic
926844483 2:17121301-17121323 CAGTGAGGAGACAGAGTGGAAGG - Intergenic
927214697 2:20661757-20661779 AGGAGAGGCAACAGAGAAGAAGG - Intergenic
927438373 2:23089973-23089995 GAGAGAGGGAGAAGAGTGGAGGG + Intergenic
927488613 2:23505774-23505796 AAGAGAGGCCAGAGAATGGTGGG + Intronic
928466717 2:31529049-31529071 AACAGAGGCAACTGAGGTGACGG - Intronic
928687606 2:33764982-33765004 AAGAGAGGTGACAAAGTTGAAGG + Intergenic
928901139 2:36318775-36318797 AATAGAGGCACTAGAGGGGAAGG - Intergenic
929930995 2:46255367-46255389 AAGAGAGGCCACAGAGAAGAAGG - Intergenic
929948832 2:46390648-46390670 AATAGAGGAAACTGAGTGCAGGG - Intergenic
929961252 2:46497904-46497926 AACAGACCCATCAGAGTGGAGGG - Intronic
930519156 2:52441415-52441437 GTGAGAGGGAACAGAGTGGGAGG + Intergenic
931529385 2:63197073-63197095 AGGAGAGGCAAGAGAGAGGTAGG - Intronic
932430646 2:71671983-71672005 AAGAGAGGTCAGAGAGTGGAAGG + Intronic
932780539 2:74556043-74556065 TAGCGACGCAACAGAGTGTAGGG - Exonic
935056260 2:99570167-99570189 AAGAGAGAAAACGGAGTGGCAGG - Intronic
935175828 2:100648002-100648024 GAGAGAGGCAACTGAGTGGTTGG + Intergenic
936445362 2:112590547-112590569 AAGGGAGACAATAGAGAGGAAGG + Intergenic
936501525 2:113070502-113070524 AGGTGGGGCAACAAAGTGGAGGG - Intronic
936720489 2:115246628-115246650 AGGAGAGGCGACAGAACGGAGGG + Intronic
937111957 2:119373340-119373362 ATGAGAGGGAACATGGTGGAGGG - Intergenic
937491031 2:122367820-122367842 CAGAGACCCACCAGAGTGGAAGG - Intergenic
937872192 2:126793853-126793875 AAGGGAGGCAGAAGAGAGGAAGG + Intergenic
940867123 2:158828295-158828317 GTGAGAGGCAACGGAGTAGATGG - Intronic
941410068 2:165143587-165143609 AGAAGATGCAGCAGAGTGGAGGG + Intronic
941657621 2:168160919-168160941 AGGAGAGGCACCAGAGTCGGGGG + Intronic
942208196 2:173644596-173644618 AACAGAGGCATGAGTGTGGAAGG + Intergenic
942414021 2:175739455-175739477 AAGAGATGCAACAGAATTGGAGG + Intergenic
943398443 2:187372433-187372455 AAGAAAGGGAACAGAGAGGGAGG - Intronic
943434419 2:187846952-187846974 AAGAAAGACAACAGAATTGAAGG - Intergenic
944944909 2:204672705-204672727 AAGAGAAGCACCAGAATGGTAGG - Intronic
945448146 2:209962310-209962332 ATGAGAGGCCACAGAGAGGAGGG + Intronic
946074794 2:217064859-217064881 GTGAGAGGGAACAGAGTGGGTGG - Intergenic
946232697 2:218302409-218302431 AAGAGTAGCTACAGAGGGGATGG + Intronic
948182070 2:235989877-235989899 AAGAGATGAAAGAGAGGGGAGGG + Intronic
1168743592 20:216370-216392 TGGAGAGGCACCAGAGAGGAAGG - Intergenic
1169469467 20:5871709-5871731 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
1169985944 20:11444597-11444619 AAGGGAGGAAACAGTGTAGAAGG - Intergenic
1170416983 20:16154837-16154859 AAGACAAGCCACAGACTGGAAGG + Intergenic
1170763329 20:19270832-19270854 AAGAGAGGAGAGAGAGAGGAAGG + Intronic
1170787412 20:19479577-19479599 AAGAGAGACAAGAGAGGGAAAGG + Intronic
1171148005 20:22802684-22802706 AAGAGAGGAAAGAGAGAGGGAGG + Intergenic
1171538691 20:25924854-25924876 AAGTGTGGCAGCAGAGTTGATGG + Intergenic
1171802341 20:29635428-29635450 AAGAGTGGCAGCAGAGTTGATGG - Intergenic
1172029859 20:31974211-31974233 AAGAGAGAGAATAGACTGGAGGG + Intronic
1172215977 20:33236058-33236080 CAGAGGGGCCACAGAATGGATGG - Intronic
1172412144 20:34732946-34732968 AAAAGTGGCAACAAGGTGGATGG - Intronic
1173606642 20:44336532-44336554 GAGAGAGGCAACAATGTGGCTGG - Intergenic
1173851141 20:46219019-46219041 CATACAGGCAACAGAATGGAAGG + Intronic
1173976667 20:47192079-47192101 AGGAGAGGAAACAGAGTCCAGGG - Intergenic
1174805996 20:53604949-53604971 CAAAGGGGCTACAGAGTGGAGGG + Intronic
1174906661 20:54559218-54559240 TTGAGAGGAAATAGAGTGGAAGG + Intronic
1175173671 20:57096648-57096670 GAAAGAGGTAACAGAGAGGAAGG - Intergenic
1175783461 20:61697892-61697914 AAGAGAAGAAACAGATGGGAGGG - Intronic
1176732812 21:10517769-10517791 CAAAGGGGCTACAGAGTGGAGGG - Intergenic
1177333344 21:19690723-19690745 AAGAGAGACAACAGAGTTAAAGG - Intergenic
1178597053 21:33963583-33963605 AAAATGGGCAAGAGAGTGGAGGG - Intergenic
1178778754 21:35578895-35578917 AAGAGAGAGAAGAGAGAGGAAGG + Intronic
1179370876 21:40805130-40805152 AAGAGAAGTAGCAGACTGGAGGG - Intronic
1179404082 21:41111128-41111150 AAGAGTGGTACCAGAGAGGAAGG + Intergenic
1179483056 21:41690669-41690691 GAAACAGGCAACAGAGTGGAGGG - Intergenic
1180122244 21:45761586-45761608 AAGAGAGACGCCAGACTGGAAGG - Intronic
1180577312 22:16790547-16790569 ATTAGAGGCTACAGAGTGGGAGG + Intronic
1180898076 22:19351887-19351909 AAGAGGGGCAACTGAGTGGAGGG + Intronic
1181484384 22:23221358-23221380 GAGAGAAGCAGCAGACTGGATGG - Intronic
1181610798 22:24010457-24010479 AAAAAAGGCGACAGAGTTGAAGG - Intergenic
1181629789 22:24144676-24144698 AGGAGGGGCAACAGAGTGCCAGG - Intronic
1183668713 22:39259598-39259620 AAGAGAGACATCAGGGTGGGTGG + Intergenic
1183751109 22:39721052-39721074 AAGAGAGGAAACAGAAGGGAAGG + Intergenic
1183899185 22:40992202-40992224 AAGAGATTCACCAGAGTGGGAGG + Intergenic
1184341383 22:43887935-43887957 AACTGAGGCAAGAGAGGGGAGGG - Intronic
1185263482 22:49884725-49884747 AAGGAAGGCAGCAGAGTGGGAGG - Exonic
950146699 3:10655249-10655271 AGGAGAGGGAGGAGAGTGGAGGG - Intronic
950276168 3:11663061-11663083 AAGCGAGGCAGCAGAGTAAAAGG + Intronic
950753916 3:15156090-15156112 AAGGGAGGGAACAGAGGGGAAGG + Intergenic
950954339 3:17035514-17035536 ATGAGAGGCAGCAGAGGGGCTGG - Intronic
951354125 3:21643282-21643304 AAGAGAGGAAAGAGAGGAGAAGG + Intronic
952148222 3:30557116-30557138 AAGAAAGGTAAAAGAATGGAGGG + Intergenic
952660277 3:35837832-35837854 AAGAGAGACAAGAGAATGGCTGG + Intergenic
953386604 3:42509854-42509876 AAGAGAGGGCACAGAGAGGAGGG - Intronic
953712964 3:45290553-45290575 CCGAGAAGCAGCAGAGTGGATGG + Intergenic
954292958 3:49659369-49659391 AAAAGAGACAACAGAGTGAGGGG + Intronic
955059968 3:55485760-55485782 AAGAGAGGCGAGAGAGGAGAAGG + Intronic
955330019 3:58039720-58039742 AAAAGAGGCAATAAAGTGAATGG - Intronic
955411633 3:58659215-58659237 GCGAGAGGCAGCAGAGTGAAGGG - Intronic
956586958 3:70875218-70875240 AAGAGAGGCAAGAGAGAGAGGGG - Intergenic
956790807 3:72678664-72678686 AATAGAGGGAAGAGGGTGGATGG + Intergenic
956895795 3:73658481-73658503 AAAGGAGGCAGAAGAGTGGATGG + Intergenic
957191953 3:77021323-77021345 AAGAGGGGCAAGAGACAGGAGGG - Intronic
958603947 3:96333702-96333724 AAGAGAGTAAAGAGAGAGGAAGG - Intergenic
959314004 3:104778931-104778953 AGGAGAGGCAACAGAGAGACGGG - Intergenic
959782494 3:110252814-110252836 AAAAAAGTCAACAGAGTGAAAGG + Intergenic
960077791 3:113507565-113507587 AAGAGAGAGTACAGAGTGCAAGG - Intronic
960765364 3:121122854-121122876 GAGATAGGCAACAAAGTGGGAGG + Intronic
961174305 3:124821270-124821292 AAGAGAGGCAACAGGGAGGGGGG + Intronic
961247009 3:125463374-125463396 AAGATAGGAAACACAGTGTAGGG + Intronic
961637860 3:128344226-128344248 TAGAGTGGTGACAGAGTGGAGGG - Intronic
961718349 3:128874612-128874634 AAGTGTGTCAACAGGGTGGAAGG + Intergenic
961719272 3:128881706-128881728 AAGTGCGTCAACAGGGTGGAAGG - Intronic
962006158 3:131352139-131352161 AAGAGAGACAACAGAAAGAAAGG - Intergenic
962286055 3:134086312-134086334 AGGAGAGGAGAGAGAGTGGATGG + Intronic
962928658 3:140017714-140017736 TCTAGAGGCAACAAAGTGGAAGG + Intronic
962996861 3:140637552-140637574 AAAGGTGGGAACAGAGTGGAAGG - Intergenic
963369318 3:144377905-144377927 AACAGAGGCATGAGTGTGGAAGG - Intergenic
964972429 3:162578241-162578263 AAGAGAGGGAAGAGAGTGTGGGG + Intergenic
965176209 3:165336613-165336635 AAGAGAAGAAACAGAGAGGAAGG + Intergenic
966193707 3:177293765-177293787 AAGAAGGGCAACTGATTGGAAGG + Intergenic
967332134 3:188301088-188301110 TAGAGAGGCAGGAGGGTGGATGG - Intronic
967417024 3:189230487-189230509 AAGAGAGCAAAGAGAGTGGAGGG - Intronic
969109050 4:4829910-4829932 AAGAGAGTCAGCAGGGAGGATGG + Intergenic
969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG + Intronic
969465604 4:7354444-7354466 AAGAGAGACAACAAGGTGCAGGG + Intronic
969481325 4:7448574-7448596 AAGAGAGGGAAAGGAGAGGAAGG - Intronic
969481397 4:7448824-7448846 AAGAGAGGGAAAAGAGAGAAAGG - Intronic
970733723 4:19140699-19140721 AAGAGGAGCAAGAGAGTGAAGGG + Intergenic
971406501 4:26325407-26325429 AAGAGAGGCAACAGAGTGGAGGG + Intronic
972067441 4:34967435-34967457 AAGAGAAACCACAGAGTGCATGG + Intergenic
972551418 4:40138383-40138405 AACAGAAACAACAGAGTGAAAGG - Intronic
973172728 4:47165322-47165344 GAGGGAGTCAACAGAGAGGAAGG - Intronic
975252188 4:72193324-72193346 AAGAAAGGCAACATATTAGAAGG + Intergenic
975755224 4:77565097-77565119 ATGAGAGGGAACTGAATGGAGGG + Intronic
976080594 4:81350875-81350897 AGGAGAGATAACAGAGTGGGTGG - Intergenic
976155015 4:82134533-82134555 AAGGGAGGGAATAGAGTGGAGGG + Intergenic
976840384 4:89426060-89426082 AAAACAAGCAAGAGAGTGGAAGG + Intergenic
977032690 4:91906726-91906748 AAGAGGGGCTACAGTGTGGCAGG - Intergenic
977190965 4:94000302-94000324 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
977514538 4:98004938-98004960 AAAATAGTCAACAGAGTGAAGGG - Intronic
977563250 4:98555069-98555091 AAGAGAGCTAACAGCGTGGGTGG + Intronic
977650600 4:99464342-99464364 AAGAGAAGCAACAGAATGTGTGG - Intergenic
977666972 4:99653607-99653629 AGGAGATGGAACAGAGTGCAGGG - Exonic
978243754 4:106548706-106548728 AAGAGAGGGAGGAGAGTAGAGGG - Intergenic
978243764 4:106548739-106548761 AAGAGAGGGAGGGGAGTGGAGGG - Intergenic
979438846 4:120727105-120727127 TGTAGAGGCAACAGAGTGAAGGG - Intronic
980171453 4:129294864-129294886 AAGAGAAGCAAGAAAGTTGAGGG + Intergenic
980967715 4:139539183-139539205 AAGGAAGGGAACACAGTGGAAGG - Intronic
980974613 4:139598825-139598847 GAGAGAGGCAGCAGGGTGGTGGG - Intronic
983503014 4:168521608-168521630 AAGAGAGGAAACAGAGTCAAAGG - Intronic
983518501 4:168681435-168681457 AAGAATGGCAACAGAATGGTTGG + Intronic
983577546 4:169274692-169274714 AAGAGTGGAAACAGAGAGGCTGG - Intergenic
984379034 4:178966686-178966708 AAGAAAGGGGAGAGAGTGGAAGG + Intergenic
985393635 4:189517489-189517511 AAGCGAGGCCCCAGAGTGGCAGG + Intergenic
986132380 5:4943129-4943151 AGGAGAGGCCAGAGAGGGGAAGG + Intergenic
986190036 5:5487871-5487893 AAGACAGCCATCTGAGTGGATGG + Intronic
986205195 5:5617757-5617779 AAAAGAGGCAAAAGATTTGAAGG - Intergenic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
988438880 5:31209359-31209381 AAGAGAGGTTACTGATTGGAAGG - Intronic
988961162 5:36372962-36372984 ATGAGAGGCCACAGACAGGAGGG + Intergenic
988985480 5:36614410-36614432 AAGAGAGCCAAGAGAGTTGTAGG + Intronic
990406088 5:55492521-55492543 AGAAGAGGCAACTGAGTTGAAGG + Intronic
990774125 5:59286005-59286027 AAGAGAGGTAAAAGAAAGGAAGG - Intronic
991505944 5:67324292-67324314 AAGTGAGGAAAGAGAGGGGAAGG + Intergenic
994181259 5:96768873-96768895 CAGAGAGGTAACAGAGAGCAAGG - Intronic
994564372 5:101422913-101422935 AAGAGCACCAATAGAGTGGAAGG + Intergenic
994910501 5:105899240-105899262 AAGAGAGACAATGCAGTGGAAGG - Intergenic
995601182 5:113798521-113798543 AGGAGAGGAAACAGAGCTGACGG - Intergenic
995752070 5:115462475-115462497 GATAGGGGCAACAGAGGGGAGGG + Intergenic
995840662 5:116440508-116440530 AAGAGAGGCAGCTGAATGGTGGG - Intergenic
996584466 5:125069331-125069353 AAAACAGGAAAGAGAGTGGAAGG - Intergenic
996607842 5:125344758-125344780 AGGAGATGCTACAAAGTGGAAGG - Intergenic
996800957 5:127402451-127402473 AAGAGAGGAAATAGAAAGGAGGG - Intronic
998216133 5:140239814-140239836 AAGAGAGGCAAGCCAGTGCAGGG + Intronic
998762822 5:145451296-145451318 AAGAGAGGTGACAGAGTGGTAGG - Intergenic
998986098 5:147759034-147759056 AAGAGAGGCAACAAATTTTAAGG + Intronic
999218031 5:149952098-149952120 AAGAAAGGCAACAGGCAGGAAGG + Intergenic
1001455307 5:171855575-171855597 AATAGAGTGAGCAGAGTGGAGGG + Intergenic
1001602129 5:172935750-172935772 AAAAGAGAGAACAGAGAGGAAGG - Intronic
1002082546 5:176746072-176746094 CAGATGGGCAAGAGAGTGGAAGG + Intergenic
1002154936 5:177269771-177269793 AAGATGGGCAAAGGAGTGGATGG + Exonic
1002451449 5:179321359-179321381 GTGAGAGGCAAGGGAGTGGAGGG - Intronic
1002893212 6:1355804-1355826 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
1003452940 6:6253498-6253520 ATGAGAGGCACCAGAGCAGAGGG + Intronic
1003733069 6:8847731-8847753 AGGAGAGGAGACAGTGTGGATGG - Intergenic
1003782296 6:9443169-9443191 AAGAAAGGCAACAAAGTAAAGGG + Intergenic
1004687850 6:17964215-17964237 AAGAGAAGGAAGAGAGTTGATGG - Intronic
1004841199 6:19587105-19587127 CAGAGATGCAACAGAAAGGAAGG + Intergenic
1005130268 6:22498758-22498780 AAGAGAGCCAAGATAGAGGAGGG - Intergenic
1005705138 6:28443922-28443944 AAGAGAGGGAGCAGTGTGAAAGG - Intergenic
1006952221 6:37832246-37832268 AAGAGCAGCGACAGATTGGATGG + Intronic
1007313261 6:40963612-40963634 AAGGGAGGCAGCAGAGTGCAGGG - Intergenic
1008394789 6:50993890-50993912 GAGAGATGCAAAAGAGTGTAAGG + Intergenic
1008784142 6:55145029-55145051 AAAAGAAGCAACAAAGTAGACGG - Intronic
1009422561 6:63480042-63480064 AAGAGAGGAAACAGGGTGCCTGG - Intergenic
1009886637 6:69631351-69631373 AAGAGAGGAAATAAAGTGGTGGG - Intergenic
1010060120 6:71613253-71613275 GAGGGAGGCAACAAAGTGAATGG - Intergenic
1010253142 6:73729182-73729204 AAGAGAGACAACAGGGAAGAAGG + Intronic
1010445375 6:75943438-75943460 AAGAGAGGAAGCAGAGGAGAGGG - Intronic
1010515903 6:76772282-76772304 AAGAAAGGCAACTAAGTGGATGG + Intergenic
1011198089 6:84803083-84803105 AAGAGAGGAAAAAGAGCGGGAGG + Intergenic
1012503746 6:99920577-99920599 CAGTGAGGCCACAGTGTGGAGGG + Exonic
1013111437 6:107068345-107068367 AAGAGGGGCAAGAGAGTTGCTGG + Exonic
1013542797 6:111127786-111127808 AAGGGTGGAAACAGAGTAGAGGG + Intronic
1013682311 6:112538279-112538301 AAGACATGAAAGAGAGTGGATGG - Intergenic
1014299115 6:119658535-119658557 AAGAAAGGCAACTTAGTGCAGGG + Intergenic
1014727133 6:124984564-124984586 AAGAAAGAAAATAGAGTGGAGGG + Intronic
1014913165 6:127118028-127118050 GAGAAAGGCAACAGAGGAGAAGG + Intergenic
1014975930 6:127884125-127884147 AAGAGAAGCAGCAGAGTGTAGGG - Intronic
1015146962 6:129997756-129997778 AAGAAAGACAACTGGGTGGATGG + Intergenic
1015359687 6:132324824-132324846 AAGAAAGGAAACTGAGGGGAAGG - Intronic
1015637923 6:135297323-135297345 AAGAGAGGGGAGAGAGTGGGAGG - Intronic
1016648757 6:146439873-146439895 AAGGCAGGCAACAGGGTGGTAGG + Intergenic
1016752191 6:147643097-147643119 AAGAGAGGGGTCAAAGTGGAGGG - Intronic
1017388696 6:153914337-153914359 AAGAGAGGCAAGAGAGGCAAGGG + Intergenic
1017500880 6:155021694-155021716 AAATGAGGCAACTGAGGGGATGG - Intronic
1018323141 6:162634491-162634513 GAGAGAGGCAGGAGAGTGTATGG - Intronic
1018358810 6:163045089-163045111 AAGATGGGCAACAGAGTTGCTGG - Intronic
1019634953 7:2070521-2070543 AAGAGAGGCCACACCGGGGAGGG + Intronic
1019964077 7:4484666-4484688 AAGAGAGGTGAGAGAGGGGAGGG + Intergenic
1020834197 7:13127921-13127943 AAGAGACACAACAGAGAGGAAGG - Intergenic
1021228026 7:18051293-18051315 AAAAGGGGCAACAGAGTTGTTGG + Intergenic
1022624790 7:32024201-32024223 AAGGGAGGAAACAGGGAGGAAGG + Intronic
1022687275 7:32608731-32608753 TAGAGGGACAACAGAGAGGAAGG + Intergenic
1023820940 7:43980220-43980242 AAGAGAGGCAGCTGAGGGGAGGG + Intergenic
1024043456 7:45572735-45572757 AAATGAGGCTACAGAGTGGTGGG + Intergenic
1024526019 7:50350056-50350078 AAGAGGGGCAGCAGGGTGTAGGG + Intronic
1025290077 7:57710776-57710798 AAGTGTGGCAGCAGAGTTGATGG + Intergenic
1025971491 7:66330269-66330291 AGGAGAGGCAAGGGAGTTGAAGG + Intronic
1026520511 7:71113718-71113740 AAGAAAGGAAAAAGAGGGGAGGG - Intergenic
1026760935 7:73125194-73125216 CAGTGAGGCAGCAGCGTGGATGG - Intergenic
1026886603 7:73952746-73952768 CAGAGAGGAAACAGATTGGGGGG - Intergenic
1027037277 7:74933990-74934012 CAGTGAGGCAGCAGCGTGGATGG - Intergenic
1027086285 7:75267462-75267484 CAGTGAGGCAGCAGCGTGGATGG + Intergenic
1027328357 7:77065354-77065376 AAGAGAGGCAGCTGAGGGGAGGG - Intergenic
1028146205 7:87322719-87322741 AAGAGATGAAAATGAGTGGATGG - Intergenic
1029126241 7:98296947-98296969 AGGAAAGGGAACAGAGAGGAGGG - Intronic
1029392588 7:100285489-100285511 CAGTGAGGCAGCAGCGTGGATGG + Intergenic
1029749214 7:102533660-102533682 AAGAGAGGCAGCTGAGGGGAGGG + Intergenic
1029767157 7:102632764-102632786 AAGAGAGGCAGCTGAGGGGAGGG + Intronic
1030303959 7:108001742-108001764 AGGACAGGCAACAGAGTTGGGGG + Intronic
1030305727 7:108017402-108017424 GAGAGAAGAAACAGGGTGGAGGG + Intergenic
1030541617 7:110837336-110837358 AAGAGAGAGAAAAGAGGGGAAGG + Intronic
1032423777 7:131803854-131803876 AGCAGAGGGAAGAGAGTGGAAGG - Intergenic
1032463238 7:132127049-132127071 AAGACAAGAAACAGAGTGGTAGG - Exonic
1033848203 7:145461573-145461595 AAGAGAGGGAATAAATTGGAAGG - Intergenic
1034408424 7:150922137-150922159 AAGAGAGGCAGCAGTATGGAAGG + Intergenic
1034494538 7:151411641-151411663 AGGAGAGGAACCAGAGTGCATGG - Intergenic
1034550086 7:151814924-151814946 AAGACAGGCAGCAGGATGGAGGG + Intronic
1035162000 7:156958050-156958072 GAGAAAGGCAACAGACTGGCGGG - Intronic
1036750334 8:11439834-11439856 AAGAGAGAAAACAGAAAGGAGGG + Intronic
1037695136 8:21217018-21217040 ACCAGAGGCAACTGAGTGGAGGG - Intergenic
1038542645 8:28402301-28402323 AAGGAAGGAAAGAGAGTGGAGGG + Intronic
1039582208 8:38676012-38676034 AAAAGAGGGAACAGAGTCTATGG + Intergenic
1040055601 8:43054883-43054905 ATGAGTGGCCACAGAGAGGAGGG + Intronic
1040305677 8:46210581-46210603 AAGAGAGACAACAGGGTGGCTGG + Intergenic
1040514516 8:48123968-48123990 ATGAGAGGCAACAGAATGGAAGG - Intergenic
1040896457 8:52373747-52373769 GGGAGAGGCAACAGAGTTGGGGG - Intronic
1041546799 8:59054936-59054958 AAGAAAGGAAAAAGAGAGGAGGG + Intronic
1042075807 8:64993464-64993486 AAGAGAGGCAACAGCATGGTTGG - Intergenic
1042400300 8:68337450-68337472 AAGAGAGGCCTCAGACTGAAGGG + Intronic
1042638932 8:70910979-70911001 AAGAGAAGCAACAGAAGAGAAGG - Intergenic
1043259766 8:78181821-78181843 AAGAGAAGCAATAAAGTGCATGG + Intergenic
1043659228 8:82714771-82714793 AAAAAAGTTAACAGAGTGGAGGG - Intergenic
1044426908 8:92062633-92062655 ATGAGTGGCAGCAGAGAGGAGGG + Intronic
1044682470 8:94795849-94795871 AAGAGAATCAACTGAATGGAAGG - Intergenic
1045449996 8:102313387-102313409 AAGAGAGGAGAAAAAGTGGAAGG + Intronic
1045826114 8:106400501-106400523 AAAAGAGGAAACTGATTGGAAGG - Intronic
1045837372 8:106537876-106537898 GAGAGAGGAAAAAGAGGGGAGGG + Intronic
1046687893 8:117247429-117247451 AAGAGAGGGAACAGAGATGAGGG + Intergenic
1046934817 8:119875490-119875512 AGGAGAGGCTACAAAGTAGAAGG + Intronic
1047181439 8:122592602-122592624 AAGAGAAGCAAAAGAGTTGCAGG + Intergenic
1048064160 8:130950598-130950620 AAGCAAGGCCACAGAGTGAAAGG - Intronic
1049038415 8:140094597-140094619 CGGAGAGGCAGCAGAGTAGAGGG + Intronic
1049675234 8:143886233-143886255 AAGAGAGGGGACAGAGAGCAGGG + Intergenic
1050120771 9:2304944-2304966 AAGTGAGGAAACAGAGGGGAGGG + Intergenic
1050604421 9:7285834-7285856 AAGGCAGGAAACTGAGTGGATGG - Intergenic
1050806615 9:9688026-9688048 AAGAAAGGAAAGAGAGTGCAGGG - Intronic
1050877701 9:10660458-10660480 AATAGAAAAAACAGAGTGGACGG + Intergenic
1051115680 9:13691714-13691736 AAGACAAGCCACAGACTGGAAGG - Intergenic
1052592504 9:30515901-30515923 AACAGAGGCAAGAGAGAGAAGGG - Intergenic
1052940180 9:34126593-34126615 AAGAAAGGAAAGAGAGAGGAAGG + Exonic
1054166348 9:61734630-61734652 AAGTGTGGCAGCAGAGTTGATGG - Intergenic
1054717776 9:68574091-68574113 AAGAGAAGCAACTGGGAGGAGGG + Intergenic
1055062672 9:72086750-72086772 GAGAGAGGGAACACAGTAGATGG - Intergenic
1055791895 9:79931377-79931399 AAGAGAGGCAGCATAGTGTGGGG - Intergenic
1056002713 9:82233812-82233834 AAGAGAGGGAACTTAGAGGATGG + Intergenic
1056547513 9:87625108-87625130 AACAGATGCAAGAGAGTGTATGG + Intronic
1056856235 9:90131988-90132010 CAGTGAGGAAAGAGAGTGGAAGG - Intergenic
1057192131 9:93094204-93094226 AAGGGTGGCGACGGAGTGGAAGG - Intergenic
1057767327 9:97933731-97933753 GAGAGAGGCAGCAGAGTGCATGG - Intronic
1058003448 9:99890735-99890757 CATAGAGGCAAGAAAGTGGATGG + Intergenic
1058348326 9:103991205-103991227 GAGAGAGGCAAGAGAGTCAAAGG - Intergenic
1060291229 9:122304816-122304838 AAGAGAGGAAATAGAGCAGAAGG + Intronic
1061300382 9:129701194-129701216 AAGATAGGAAACAGAGCAGAGGG + Intronic
1062154889 9:135041961-135041983 GTGAGAGGAAAAAGAGTGGAAGG - Intergenic
1203620503 Un_KI270749v1:123484-123506 AAGAGAGGCGAGAGAGAGGTGGG - Intergenic
1187039404 X:15577866-15577888 AAGAGAGGTAACTGAATGAATGG - Intronic
1187186278 X:16989495-16989517 AAGACAGACTACAGAGTGGGGGG + Intronic
1187351691 X:18524537-18524559 AAGACATGCCACAGACTGGAAGG - Intronic
1187393237 X:18899270-18899292 AAGAGACACAGCAGAGAGGAGGG + Intronic
1187877313 X:23815072-23815094 ACGAGAGACAACCGGGTGGAAGG + Intergenic
1188614949 X:32146378-32146400 GAGAGAAGTAACTGAGTGGATGG + Intronic
1188895810 X:35667350-35667372 AAGAGAGGTAAGAGATGGGAGGG - Intergenic
1188991253 X:36823182-36823204 AAGAGAGTCAACAGGGTTCAGGG + Intergenic
1189124469 X:38431643-38431665 CAGAGTGGCAACAGAATGCAAGG - Intronic
1189183089 X:39022030-39022052 AAGACAAGCTACAGAGTGAAAGG - Intergenic
1189431862 X:40954170-40954192 TAGAGAGGGAACAGAGCAGAGGG + Intergenic
1189808470 X:44758850-44758872 GAGAGAGGGAACAGGGTGGGAGG + Intergenic
1190118284 X:47639697-47639719 AAGAGGAGCTACAGTGTGGAGGG - Intronic
1190633374 X:52411108-52411130 AAGGTGGGCCACAGAGTGGAGGG - Intergenic
1191676476 X:63796908-63796930 AAGAGAGGCATGAGAGGAGATGG - Intergenic
1192297184 X:69863147-69863169 AGGAGAGGCAAGAGAGAGGATGG - Intronic
1194112594 X:89853807-89853829 ATGAGAGGCAAGAGCGGGGAGGG + Intergenic
1194779112 X:98001365-98001387 AAGAGAGGAAACAAAGTTGGAGG + Intergenic
1195141702 X:101967282-101967304 GAGAGAGGCAAAAGTGTGGCAGG - Intergenic
1196790410 X:119459340-119459362 AAGAGCAGCAAAGGAGTGGATGG + Intergenic
1196843581 X:119880778-119880800 AAGAGAGGGACCAGAGAGGTTGG + Intergenic
1198647159 X:138821778-138821800 AATACATGGAACAGAGTGGAGGG + Intronic
1199761390 X:150906926-150906948 AGGAGAGGCAACAGATTGTATGG + Intergenic
1199781311 X:151062822-151062844 AAAAGAGGGAAAAGTGTGGATGG - Intergenic
1199926347 X:152469285-152469307 ACCAGAGGCTACAGAGTGAAGGG + Intergenic
1200051718 X:153435646-153435668 AACAGAGGCCTCAGAGAGGAAGG + Intergenic
1200465247 Y:3508619-3508641 ATGAGAGGCAAGAGCGGGGAGGG + Intergenic
1201341801 Y:12942310-12942332 AAGAGACGCAGCAAAGGGGAAGG + Intergenic