ID: 971412871

View in Genome Browser
Species Human (GRCh38)
Location 4:26393802-26393824
Sequence GGGTGCAGAGAGTTTAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971412871 Original CRISPR GGGTGCAGAGAGTTTAAAAT TGG Intronic
901412098 1:9091562-9091584 GGGTTGAGAGAGTTGAATATAGG - Intergenic
901667038 1:10831882-10831904 GAGGCCAGAGAGTTTAAAATAGG - Intergenic
909704035 1:78559783-78559805 TGATGCAGATAGTTTAAAACTGG - Intergenic
909954360 1:81759985-81760007 GGCTGGAGTGAGTTTCAAATTGG + Intronic
913031399 1:114907391-114907413 GAAGGCAGAGAGTTTAAAAGAGG - Intronic
914411824 1:147436643-147436665 GGGTTCAAAGAGTTTCTAATTGG - Intergenic
915776587 1:158495199-158495221 ACGTGCAGAGAGCTTCAAATAGG + Intergenic
916206412 1:162319844-162319866 GGCTGAAGAGAGTTTAATACAGG - Intronic
916608126 1:166363354-166363376 GGGTACAGAGAGTTCCAAATAGG - Intergenic
919022729 1:192128631-192128653 AGGTGGAGATAGTTTAAATTGGG - Intergenic
919556727 1:199064744-199064766 AGGTGCAGAGAGGTAGAAATGGG - Intergenic
923334210 1:232952858-232952880 GGGTACAGACAGTTGGAAATCGG - Intronic
924488084 1:244506938-244506960 GGAGGCAGAGAGTTGAAAAGCGG - Intronic
1064700071 10:18009442-18009464 GGGGGAAGAGGGTTTGAAATTGG - Intronic
1065977296 10:30853651-30853673 GGGAGCAGGGAGTTCACAATGGG - Intronic
1070674530 10:78403279-78403301 GAGTGCAAAGAGTGTGAAATAGG + Intergenic
1071797204 10:89019631-89019653 GAGTGCAGAGAGAAAAAAATGGG - Intergenic
1072344453 10:94489518-94489540 GTGTGCAGATAGTTAAAATTTGG + Intronic
1073703504 10:105956716-105956738 GGGTGCTGAGAATTGAGAATAGG - Intergenic
1075068172 10:119303669-119303691 GGGTGGAGATAGTTTGAAAGGGG + Intronic
1075834999 10:125445466-125445488 GGGTTGAGAGAGTTCAAGATTGG - Intergenic
1076385852 10:130054933-130054955 GGGTGCCAAGAATATAAAATGGG + Intergenic
1079801991 11:24880279-24880301 GCGTGGAGAGAGTCTAAATTTGG - Intronic
1080605656 11:33862770-33862792 GGCAGCAGAGAGCTTAAGATGGG - Intronic
1081199740 11:40201737-40201759 GGGAGCAGTGATTTTAGAATAGG + Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1087119525 11:94559106-94559128 GGGTGTTGTGAGTGTAAAATGGG - Intronic
1087678949 11:101196452-101196474 GAGTATAGAGAGTTTAAAAAGGG + Intergenic
1090321741 11:125850905-125850927 GGGTGCATAGAGTGCAAAACAGG - Intergenic
1091063384 11:132485984-132486006 CACTGCAGAGAGTTTAAAACAGG - Intronic
1095712624 12:45306840-45306862 GGGTGGTGACAGTTTTAAATAGG + Intronic
1096111275 12:49030706-49030728 GGGGGCAAAGAGGCTAAAATTGG + Exonic
1096246212 12:49988753-49988775 GGGTCCAGAGAGTGGGAAATGGG + Intronic
1097165973 12:57087127-57087149 GGGAGCGGAGAGCTCAAAATCGG + Intronic
1100909003 12:99337094-99337116 GGATGAAGAGAGATTGAAATAGG - Intronic
1102089669 12:110174833-110174855 GGGAGCCGAGTCTTTAAAATTGG + Intronic
1104165823 12:126228945-126228967 GTATGCAGAGAGTTTAAAATAGG + Intergenic
1106090904 13:26592544-26592566 GGGTGCAGAGAGTGTGAGTTTGG + Intronic
1106765933 13:32914052-32914074 GGAGGCAGACAGTTGAAAATGGG + Intergenic
1108433869 13:50382400-50382422 GGCTGCAGAGCGTTTCAAATTGG + Intronic
1109387549 13:61651997-61652019 AGGGGCAGAGAGTGTTAAATAGG - Intergenic
1110791043 13:79587098-79587120 GGGTCCAGGGAGTTTAGAACTGG - Intergenic
1111533865 13:89576184-89576206 GGGTGTAGGGTGTTGAAAATGGG - Intergenic
1113311585 13:109138737-109138759 GGATGGAGAGACTTTAAAAAAGG - Intronic
1115350113 14:32384841-32384863 GGGTGGGGAGAGATTAAAATGGG + Intronic
1116831218 14:49721830-49721852 GGGTGCAGAAAGCATAAAGTGGG - Intronic
1116888914 14:50248790-50248812 GTGTGCAGATAGTTAAAATTTGG - Intronic
1116924601 14:50621120-50621142 TGGTGCAGAGAGTAAGAAATGGG - Intronic
1117048851 14:51840548-51840570 AGATGCAGAGAGTTTGAGATTGG - Intronic
1117837911 14:59826935-59826957 GGGAGCAGAGTATTTAGAATGGG + Intronic
1118393589 14:65316969-65316991 TGGTGAAGAGAATTTAACATAGG + Intergenic
1118504906 14:66400597-66400619 GGTTGCTGTGAGTTTTAAATAGG - Intergenic
1119950601 14:78740135-78740157 GGGCTCTGAGAGTTTAAAAGTGG - Intronic
1120941811 14:89956399-89956421 GGGTGAAGCGAGTTTACACTTGG + Intronic
1121382668 14:93487693-93487715 TGATGCAGAGAGGTTAACATGGG - Exonic
1121914414 14:97823376-97823398 GTGTGCTGAAAGTATAAAATAGG + Intergenic
1123773255 15:23550356-23550378 GGGTGCTGAGAATACAAAATGGG - Intergenic
1126050059 15:44677124-44677146 GGGGGCAGATAGTTAAAAAGAGG + Intronic
1127460308 15:59192674-59192696 AGGTGGATAGAGTTTGAAATGGG + Intronic
1127552793 15:60057804-60057826 GGGGACTGAGAGTGTAAAATTGG - Intronic
1127883892 15:63182279-63182301 GGCAGCAAAGACTTTAAAATGGG - Intergenic
1128079138 15:64845823-64845845 GAGTGGAGAGAGTTTAGAAAGGG + Intronic
1130709938 15:86270153-86270175 GGGTTCAGAGGGTTTGAAGTTGG + Intronic
1132996871 16:2828005-2828027 GGGTGCAGAGAGGTGCAACTGGG + Intergenic
1134376337 16:13678372-13678394 TGGAGCAGAGAGTTTAATAGGGG + Intergenic
1134693049 16:16203644-16203666 GGCGGCTGAGAGTATAAAATGGG - Intronic
1134978798 16:18591051-18591073 GGTGGCTGAGAGTATAAAATGGG + Intergenic
1136296342 16:29305679-29305701 GGGAGCAGAAAGATTAAAAGGGG - Intergenic
1137807674 16:51322745-51322767 GGGGGCTGAGAGTTCAAAAAAGG - Intergenic
1139078512 16:63484718-63484740 GGCTGCAGAGAGATAAAAAATGG + Intergenic
1139622172 16:68154403-68154425 GGGTGCTGAAAGTTTAAACTAGG - Intronic
1139762539 16:69197423-69197445 GGGTACAGAGCCTTGAAAATGGG - Intronic
1142057935 16:88011823-88011845 GGGAGCAGAAAGATTAAAAGGGG - Intronic
1143247244 17:5497503-5497525 GGCTGGAGTGAGTTTAATATTGG + Intergenic
1143586382 17:7852711-7852733 GGATGGAGAGAGGTAAAAATGGG - Intronic
1145968353 17:28937841-28937863 GGGTGCAAACATTTTAAAAAGGG + Intronic
1146475439 17:33158791-33158813 GCCTGCAGAGAGCTTAATATAGG + Intronic
1148043914 17:44730659-44730681 GGGTGCAGAGACTCTTAAAGAGG + Intronic
1151618157 17:75228199-75228221 GGATGCAGGGAGTATAAAAGGGG + Intronic
1153536983 18:6112592-6112614 CGGAGCAGAGATTTTAAAATAGG - Intronic
1154272043 18:12928876-12928898 GGCTGCGGGGAGTTTAAAATAGG + Intronic
1155856168 18:30837740-30837762 GGGTGCCAAGAATATAAAATGGG - Intergenic
1156728061 18:40154304-40154326 GGGTAGTGAGAGTGTAAAATAGG - Intergenic
1156805058 18:41168292-41168314 TTGTGCAGAAAGTTAAAAATTGG - Intergenic
1163544250 19:17931803-17931825 GGGTGCAGGGGGCTTAAAGTCGG - Intergenic
1163816311 19:19466631-19466653 GTGTTCACAGCGTTTAAAATGGG + Intronic
1164103186 19:22077434-22077456 GGCTGGAGAGAGGGTAAAATGGG - Intronic
1164116491 19:22225113-22225135 GGCTGGAGAGAGGGTAAAATGGG - Intergenic
1164269319 19:23656821-23656843 GGCTGGAGAGAGGATAAAATGGG + Intronic
1164317898 19:24110684-24110706 GGTTGTAGAGAGCATAAAATAGG - Intronic
925915157 2:8599786-8599808 GGGTTCAGAGGGCTAAAAATGGG + Intergenic
929791141 2:45024039-45024061 GGGTGCAGGGAGGTTAAACTAGG + Intergenic
930587689 2:53288606-53288628 GTATTCAGAGATTTTAAAATAGG + Intergenic
930864823 2:56111988-56112010 GGGTGAAGAGAGTTATAAAGAGG - Intergenic
931622600 2:64226125-64226147 GGGGGCAGAGAATTTCAGATAGG + Intergenic
932249562 2:70230878-70230900 GGGTGAATAAAGCTTAAAATTGG - Intronic
933360657 2:81279410-81279432 AGGTGCAGATACTTGAAAATAGG + Intergenic
935528477 2:104202517-104202539 AGTGGCAGAGAGTTTATAATGGG + Intergenic
941418248 2:165248521-165248543 GGGGGCTGAGATTTTTAAATGGG - Intronic
941510690 2:166405364-166405386 TGCTGCAGTGAGTTTAAAGTGGG - Exonic
942214717 2:173707323-173707345 GCGTGCAGAGAGGCTAGAATGGG - Intergenic
942822464 2:180131551-180131573 GATTTCAGAGATTTTAAAATGGG - Intergenic
944267129 2:197740766-197740788 GGGTGCACAGAGTTTCAACTTGG + Intronic
945493614 2:210483662-210483684 TGGTGCAGAGAGAGTAAATTAGG - Intronic
947024850 2:225725875-225725897 GGGCCCAGACAGTTTAAAGTGGG + Intergenic
948300294 2:236901252-236901274 GTTTGCACAAAGTTTAAAATAGG + Intergenic
1169954961 20:11091550-11091572 GGGAGGAGAGAGTTTCAAAAAGG + Intergenic
1170394210 20:15908481-15908503 GGGTGTAAAAAGTTTAATATGGG - Intronic
1170475919 20:16714406-16714428 GAATGCAGACAGGTTAAAATTGG - Intergenic
1173257189 20:41402218-41402240 TGCTGAAGAGAGTTTAAATTTGG + Exonic
1175689744 20:61056834-61056856 GGCTGCAGAGAGTCTAAGATAGG - Intergenic
1177716282 21:24843241-24843263 AGGTTCAGAGATGTTAAAATGGG + Intergenic
1178337437 21:31756004-31756026 GGGTGGAGAGAGACGAAAATAGG - Intergenic
1183676423 22:39301405-39301427 GGGTGCAGAGGGTACAAAAAAGG + Intergenic
951090777 3:18571409-18571431 GGGTGGAAAGAGTTTACAGTAGG - Intergenic
951587777 3:24232876-24232898 GGATGCAGATAGGTTAAGATTGG + Intronic
952149320 3:30569805-30569827 GGGTGCATATATATTAAAATTGG - Intergenic
952678659 3:36065073-36065095 ACGTGCAGAGAATTTAGAATGGG - Intergenic
953244170 3:41175730-41175752 GAGTGCAGAGGGTATAAACTAGG - Intergenic
955138687 3:56247060-56247082 GGGTGCAGAGAACTAAAAACTGG + Intronic
956798930 3:72739477-72739499 GGCTGCAGAGAGGTAAAGATGGG + Intergenic
956807423 3:72829147-72829169 GGGTGAATAGAGTGAAAAATGGG + Intronic
960268462 3:115648391-115648413 GGGTGCAGTGGGTTTGAAATAGG - Intronic
960659086 3:120039547-120039569 GGGTGCAGAGTGTTTAACCAAGG - Intronic
960776044 3:121254558-121254580 GGGCACAGAAAGTCTAAAATGGG - Intronic
962582018 3:136806623-136806645 GGGTGCAGAAAGGGTAAAAAGGG + Intergenic
962582331 3:136809522-136809544 GGATGCAGAGAAATTTAAATGGG - Intergenic
965731518 3:171777257-171777279 GTGTGAAAAGAGTTCAAAATTGG + Intronic
967550576 3:190790075-190790097 AGAAGTAGAGAGTTTAAAATGGG + Intergenic
967550585 3:190790166-190790188 AGAAGTAGAGAGTTTAAAATAGG + Intergenic
968455942 4:699865-699887 AGGGGCAGAGAGTGTGAAATGGG + Intergenic
969352922 4:6608531-6608553 GGGAGCACAGAATTTAAAGTCGG + Intronic
971412871 4:26393802-26393824 GGGTGCAGAGAGTTTAAAATTGG + Intronic
972178943 4:36441320-36441342 GGGTGCAGTGAGTGTGAAAGGGG + Intergenic
974653652 4:64788579-64788601 GGGTCAACAGAGTTAAAAATAGG - Intergenic
974767615 4:66368148-66368170 GGGAAGAGAGAGGTTAAAATAGG - Intergenic
976327682 4:83791373-83791395 GGGTGGAGAGAGAATGAAATAGG - Intergenic
978366139 4:107984820-107984842 GAGTGCAGAGCTTTTAATATTGG - Intergenic
980165377 4:129220198-129220220 GGTAGAAGAGAGTTTATAATGGG + Intergenic
980453683 4:133010344-133010366 GTGTGTAGAGAGTTTAGAAAAGG - Intergenic
980501235 4:133656822-133656844 GTGGGGAGAGGGTTTAAAATTGG - Intergenic
981911157 4:149982956-149982978 ATATGCAAAGAGTTTAAAATAGG + Intergenic
983298307 4:165893808-165893830 GGGACCAGAGTGTTTAAATTAGG - Intronic
983843324 4:172483357-172483379 GAGTGCAGAGGGGTGAAAATCGG + Intronic
984118423 4:175711371-175711393 AGCTGAAGAGAGTTTAAAAAGGG + Intronic
987853558 5:23388114-23388136 TGGATCAGTGAGTTTAAAATAGG + Intergenic
988132916 5:27129079-27129101 GGGTACAGAGAGCTTGAAAGGGG - Intergenic
989609168 5:43274806-43274828 GGATACAGCTAGTTTAAAATAGG - Intronic
991648710 5:68829259-68829281 GGGTGCTAAGTGTTTGAAATAGG + Intergenic
992158882 5:73981402-73981424 GGATGCAGAGATTTTTACATAGG - Intergenic
993418323 5:87665271-87665293 GGGTGGAGGGATTTGAAAATAGG - Intergenic
993886415 5:93420559-93420581 GGGAGCAGGGAATTTAAAAAAGG + Intergenic
994500718 5:100574010-100574032 GTTTTCAGAGAGTTTAAAACAGG - Intronic
994980626 5:106871707-106871729 GGAAGCAGAAAGCTTAAAATTGG + Intergenic
995672830 5:114626080-114626102 GGTTTCAGAGAGTGTAAAGTTGG - Intergenic
996212244 5:120825614-120825636 GGGGGCTGATAGTTTAAAATTGG - Intergenic
997125834 5:131225917-131225939 GGGTGGAAGGAATTTAAAATAGG + Intergenic
997500997 5:134373147-134373169 TAGTGCAGAGCCTTTAAAATAGG + Intronic
1000016732 5:157284574-157284596 GGGTGCTGAGTTCTTAAAATAGG + Intronic
1000916900 5:167093598-167093620 GTGGACAGAGAGTTCAAAATTGG - Intergenic
1003720674 6:8698311-8698333 GGGTGCTGAGAATATAAAATGGG - Intergenic
1006278489 6:33027035-33027057 GGGTGCCAAGAGTATACAATGGG - Intergenic
1007017898 6:38487961-38487983 GGGTGCACAAAGTATGAAATAGG + Intronic
1007969916 6:46041218-46041240 AGGTGCATAGAGTTTAATAAAGG + Intronic
1008056349 6:46949948-46949970 TGCTGCAGTAAGTTTAAAATAGG - Intronic
1008499302 6:52164803-52164825 GTGTGAAGAGAGCTTAGAATAGG + Intergenic
1015365495 6:132393078-132393100 GGGTGGAGAGGGTATAGAATAGG + Intronic
1019438836 7:1036557-1036579 GGGTGCAGGGTGTTGATAATGGG + Intronic
1021104801 7:16625138-16625160 GGGTATAGAGAGTTTAGAAAGGG - Intronic
1021440946 7:20675369-20675391 GGGTGCAAAGAGTACACAATGGG + Intronic
1022052513 7:26691738-26691760 GGATGGAGAGAGTTTAAATAAGG + Intronic
1022217139 7:28274626-28274648 GGGTGAAGAGAGGTGAAAAAGGG - Intergenic
1022817475 7:33927662-33927684 GGGGGTAAAGAGTTTAAAAGTGG - Intronic
1024978890 7:55140280-55140302 GGATGCAGAGAGATGAAAACAGG - Intronic
1025773768 7:64539532-64539554 GGCTGAAGAGAGGGTAAAATGGG + Intronic
1027307792 7:76920008-76920030 GGGTGCAGACAGCCTAAACTTGG - Intergenic
1027602593 7:80257456-80257478 AGGTGCAAAGTGTCTAAAATGGG - Intergenic
1030744916 7:113153420-113153442 AGATCCAGAGAGATTAAAATGGG - Intergenic
1034702032 7:153104809-153104831 GGGTGCAGAGGGTGTAAAGTGGG + Intergenic
1037022671 8:13993123-13993145 GGGAGTAGAGAGTTTGAAGTGGG + Intergenic
1037339129 8:17823736-17823758 GTGTGCAGAGAGTTTACACATGG - Intergenic
1037653427 8:20861952-20861974 GGGAGAAGAGAGTTTAATAAAGG + Intergenic
1041186828 8:55309388-55309410 GGTTGCAAAGAGTTTAGAATGGG + Intronic
1044022483 8:87122823-87122845 AGGTGCTGAGAGTACAAAATGGG - Intronic
1048667217 8:136675814-136675836 GGGTGAAGAGACTTTTAAAAAGG + Intergenic
1052021122 9:23526274-23526296 GGGCGAAGTGAGTTTAAAAAAGG - Intergenic
1053278832 9:36803288-36803310 TGGAGCACAGACTTTAAAATAGG + Intergenic
1055855026 9:80675385-80675407 GGAATCAGAGACTTTAAAATAGG + Intergenic
1059754902 9:117283554-117283576 GGGTGCAGTGAGGTTAAGAAGGG + Intronic
1061433595 9:130546744-130546766 GGGTGCATGGAGTTTGAAAGTGG + Intergenic
1187140100 X:16585273-16585295 GGGGCTTGAGAGTTTAAAATGGG - Intergenic
1187215037 X:17267900-17267922 GTGTGCAGAGAGTTTATTAGGGG + Intergenic
1188653936 X:32666762-32666784 GGGTGCAGTGAGCTGAAATTGGG + Intronic
1194960616 X:100231202-100231224 GGGTACAGATGGTTTAGAATAGG - Intergenic
1197110636 X:122770177-122770199 GGGTAGAGAGATTTTAAAATTGG - Intergenic
1197810977 X:130442682-130442704 TTGTGTAGATAGTTTAAAATTGG + Intergenic
1198331643 X:135627973-135627995 GGGTGCAGTGAGTTGAAATCAGG + Intergenic
1198697826 X:139362653-139362675 GGGAGAAGAGAGGTAAAAATAGG - Intergenic
1199989735 X:152979689-152979711 GTGTGCACAGAATTTTAAATTGG - Intergenic
1200468495 Y:3551458-3551480 GGAAGCAGAGATTTTAAAAAAGG + Intergenic