ID: 971417890

View in Genome Browser
Species Human (GRCh38)
Location 4:26450422-26450444
Sequence TGGGCTTCCCTTGCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971417890_971417893 -5 Left 971417890 4:26450422-26450444 CCTGCTTTTGCAAGGGAAGCCCA No data
Right 971417893 4:26450440-26450462 GCCCAGTACTCAAGGAGACAGGG No data
971417890_971417892 -6 Left 971417890 4:26450422-26450444 CCTGCTTTTGCAAGGGAAGCCCA No data
Right 971417892 4:26450439-26450461 AGCCCAGTACTCAAGGAGACAGG No data
971417890_971417897 27 Left 971417890 4:26450422-26450444 CCTGCTTTTGCAAGGGAAGCCCA No data
Right 971417897 4:26450472-26450494 GAAAACCAAGTTCTTGGAACAGG No data
971417890_971417896 21 Left 971417890 4:26450422-26450444 CCTGCTTTTGCAAGGGAAGCCCA No data
Right 971417896 4:26450466-26450488 AGTTAAGAAAACCAAGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971417890 Original CRISPR TGGGCTTCCCTTGCAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr