ID: 971417892

View in Genome Browser
Species Human (GRCh38)
Location 4:26450439-26450461
Sequence AGCCCAGTACTCAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971417887_971417892 16 Left 971417887 4:26450400-26450422 CCATGTTTGTTTTAGTTTTGCTC No data
Right 971417892 4:26450439-26450461 AGCCCAGTACTCAAGGAGACAGG No data
971417886_971417892 21 Left 971417886 4:26450395-26450417 CCATTCCATGTTTGTTTTAGTTT No data
Right 971417892 4:26450439-26450461 AGCCCAGTACTCAAGGAGACAGG No data
971417890_971417892 -6 Left 971417890 4:26450422-26450444 CCTGCTTTTGCAAGGGAAGCCCA No data
Right 971417892 4:26450439-26450461 AGCCCAGTACTCAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971417892 Original CRISPR AGCCCAGTACTCAAGGAGAC AGG Intergenic
No off target data available for this crispr