ID: 971420736

View in Genome Browser
Species Human (GRCh38)
Location 4:26471925-26471947
Sequence TGCCCCAGGGTGACCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971420728_971420736 12 Left 971420728 4:26471890-26471912 CCTGCTCTAGCAGAATAGCCCAT No data
Right 971420736 4:26471925-26471947 TGCCCCAGGGTGACCAGGCCTGG No data
971420726_971420736 24 Left 971420726 4:26471878-26471900 CCCTGGTCAGCTCCTGCTCTAGC No data
Right 971420736 4:26471925-26471947 TGCCCCAGGGTGACCAGGCCTGG No data
971420731_971420736 -7 Left 971420731 4:26471909-26471931 CCATGTGGCTTCCTTCTGCCCCA No data
Right 971420736 4:26471925-26471947 TGCCCCAGGGTGACCAGGCCTGG No data
971420730_971420736 -6 Left 971420730 4:26471908-26471930 CCCATGTGGCTTCCTTCTGCCCC No data
Right 971420736 4:26471925-26471947 TGCCCCAGGGTGACCAGGCCTGG No data
971420727_971420736 23 Left 971420727 4:26471879-26471901 CCTGGTCAGCTCCTGCTCTAGCA No data
Right 971420736 4:26471925-26471947 TGCCCCAGGGTGACCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971420736 Original CRISPR TGCCCCAGGGTGACCAGGCC TGG Intergenic
No off target data available for this crispr