ID: 971421427

View in Genome Browser
Species Human (GRCh38)
Location 4:26477189-26477211
Sequence GGGTGGTCTCAGAACGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971421427_971421433 -3 Left 971421427 4:26477189-26477211 CCATGACCGTTCTGAGACCACCC No data
Right 971421433 4:26477209-26477231 CCCATATTTGGTGTAAAAATGGG No data
971421427_971421431 -4 Left 971421427 4:26477189-26477211 CCATGACCGTTCTGAGACCACCC No data
Right 971421431 4:26477208-26477230 ACCCATATTTGGTGTAAAAATGG No data
971421427_971421435 0 Left 971421427 4:26477189-26477211 CCATGACCGTTCTGAGACCACCC No data
Right 971421435 4:26477212-26477234 ATATTTGGTGTAAAAATGGGTGG 0: 27
1: 40
2: 52
3: 105
4: 880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971421427 Original CRISPR GGGTGGTCTCAGAACGGTCA TGG (reversed) Intergenic
No off target data available for this crispr