ID: 971424451

View in Genome Browser
Species Human (GRCh38)
Location 4:26502401-26502423
Sequence ACTGAAGACCAGACCGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971424451_971424455 -10 Left 971424451 4:26502401-26502423 CCCACTCCGGTCTGGTCTTCAGT No data
Right 971424455 4:26502414-26502436 GGTCTTCAGTACAATTGAGGAGG No data
971424451_971424456 -7 Left 971424451 4:26502401-26502423 CCCACTCCGGTCTGGTCTTCAGT No data
Right 971424456 4:26502417-26502439 CTTCAGTACAATTGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971424451 Original CRISPR ACTGAAGACCAGACCGGAGT GGG (reversed) Intergenic
No off target data available for this crispr