ID: 971424931

View in Genome Browser
Species Human (GRCh38)
Location 4:26506752-26506774
Sequence TAGAGCTAGAACCGACAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971424931_971424936 30 Left 971424931 4:26506752-26506774 CCTACCTGTCGGTTCTAGCTCTA No data
Right 971424936 4:26506805-26506827 GAGAGATCTTTTAAGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971424931 Original CRISPR TAGAGCTAGAACCGACAGGT AGG (reversed) Intergenic
No off target data available for this crispr