ID: 971427917

View in Genome Browser
Species Human (GRCh38)
Location 4:26533984-26534006
Sequence CTGTAGGATGATCTACTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971427917_971427927 27 Left 971427917 4:26533984-26534006 CCTTAAAGTAGATCATCCTACAG No data
Right 971427927 4:26534034-26534056 ACCAACAGTAGAGCAGGAAGAGG No data
971427917_971427923 21 Left 971427917 4:26533984-26534006 CCTTAAAGTAGATCATCCTACAG No data
Right 971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971427917 Original CRISPR CTGTAGGATGATCTACTTTA AGG (reversed) Intergenic
No off target data available for this crispr