ID: 971427919

View in Genome Browser
Species Human (GRCh38)
Location 4:26534000-26534022
Sequence AAAGGCATGGAGGATCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971427919_971427923 5 Left 971427919 4:26534000-26534022 CCTACAGGATCCTCCATGCCTTT No data
Right 971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG No data
971427919_971427927 11 Left 971427919 4:26534000-26534022 CCTACAGGATCCTCCATGCCTTT No data
Right 971427927 4:26534034-26534056 ACCAACAGTAGAGCAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971427919 Original CRISPR AAAGGCATGGAGGATCCTGT AGG (reversed) Intergenic
No off target data available for this crispr