ID: 971427920

View in Genome Browser
Species Human (GRCh38)
Location 4:26534010-26534032
Sequence GGGAAAGAGAAAAGGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971427920_971427927 1 Left 971427920 4:26534010-26534032 CCTCCATGCCTTTTCTCTTTCCC No data
Right 971427927 4:26534034-26534056 ACCAACAGTAGAGCAGGAAGAGG No data
971427920_971427930 26 Left 971427920 4:26534010-26534032 CCTCCATGCCTTTTCTCTTTCCC No data
Right 971427930 4:26534059-26534081 CTAGAAAATGAAGACACCACAGG No data
971427920_971427931 30 Left 971427920 4:26534010-26534032 CCTCCATGCCTTTTCTCTTTCCC No data
Right 971427931 4:26534063-26534085 AAAATGAAGACACCACAGGCTGG No data
971427920_971427923 -5 Left 971427920 4:26534010-26534032 CCTCCATGCCTTTTCTCTTTCCC No data
Right 971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971427920 Original CRISPR GGGAAAGAGAAAAGGCATGG AGG (reversed) Intergenic
No off target data available for this crispr