ID: 971427921

View in Genome Browser
Species Human (GRCh38)
Location 4:26534013-26534035
Sequence GTGGGGAAAGAGAAAAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971427921_971427931 27 Left 971427921 4:26534013-26534035 CCATGCCTTTTCTCTTTCCCCAC No data
Right 971427931 4:26534063-26534085 AAAATGAAGACACCACAGGCTGG No data
971427921_971427923 -8 Left 971427921 4:26534013-26534035 CCATGCCTTTTCTCTTTCCCCAC No data
Right 971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG No data
971427921_971427927 -2 Left 971427921 4:26534013-26534035 CCATGCCTTTTCTCTTTCCCCAC No data
Right 971427927 4:26534034-26534056 ACCAACAGTAGAGCAGGAAGAGG No data
971427921_971427930 23 Left 971427921 4:26534013-26534035 CCATGCCTTTTCTCTTTCCCCAC No data
Right 971427930 4:26534059-26534081 CTAGAAAATGAAGACACCACAGG No data
971427921_971427932 28 Left 971427921 4:26534013-26534035 CCATGCCTTTTCTCTTTCCCCAC No data
Right 971427932 4:26534064-26534086 AAATGAAGACACCACAGGCTGGG No data
971427921_971427933 29 Left 971427921 4:26534013-26534035 CCATGCCTTTTCTCTTTCCCCAC No data
Right 971427933 4:26534065-26534087 AATGAAGACACCACAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971427921 Original CRISPR GTGGGGAAAGAGAAAAGGCA TGG (reversed) Intergenic
No off target data available for this crispr