ID: 971427923

View in Genome Browser
Species Human (GRCh38)
Location 4:26534028-26534050
Sequence TTCCCCACCAACAGTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971427920_971427923 -5 Left 971427920 4:26534010-26534032 CCTCCATGCCTTTTCTCTTTCCC No data
Right 971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG No data
971427921_971427923 -8 Left 971427921 4:26534013-26534035 CCATGCCTTTTCTCTTTCCCCAC No data
Right 971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG No data
971427916_971427923 26 Left 971427916 4:26533979-26534001 CCTGGCCTTAAAGTAGATCATCC No data
Right 971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG No data
971427919_971427923 5 Left 971427919 4:26534000-26534022 CCTACAGGATCCTCCATGCCTTT No data
Right 971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG No data
971427917_971427923 21 Left 971427917 4:26533984-26534006 CCTTAAAGTAGATCATCCTACAG No data
Right 971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971427923 Original CRISPR TTCCCCACCAACAGTAGAGC AGG Intergenic
No off target data available for this crispr