ID: 971430906

View in Genome Browser
Species Human (GRCh38)
Location 4:26566234-26566256
Sequence ATTTATGCAAAGACAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971430904_971430906 -3 Left 971430904 4:26566214-26566236 CCTGAGCTTAATAGATACCTATT No data
Right 971430906 4:26566234-26566256 ATTTATGCAAAGACAGAGAAAGG No data
971430903_971430906 1 Left 971430903 4:26566210-26566232 CCTTCCTGAGCTTAATAGATACC No data
Right 971430906 4:26566234-26566256 ATTTATGCAAAGACAGAGAAAGG No data
971430902_971430906 26 Left 971430902 4:26566185-26566207 CCATTTAAAATTAAAGTCATTTT No data
Right 971430906 4:26566234-26566256 ATTTATGCAAAGACAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971430906 Original CRISPR ATTTATGCAAAGACAGAGAA AGG Intergenic
No off target data available for this crispr