ID: 971432859

View in Genome Browser
Species Human (GRCh38)
Location 4:26586870-26586892
Sequence TTCATTATGATACATGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971432859 Original CRISPR TTCATTATGATACATGTACC TGG (reversed) Intronic
902589757 1:17465366-17465388 TTGATTATGACACTTGTACATGG + Intergenic
903040167 1:20523546-20523568 TTCATTATTATTTATGTTCCTGG + Intergenic
906264875 1:44421068-44421090 TTCATTATTATCCATCCACCAGG + Intronic
907604074 1:55798862-55798884 TTCAATATGAAAAATGTTCCAGG + Intergenic
908066894 1:60415651-60415673 TTCATTCTGATTCATTTTCCTGG + Intergenic
908774000 1:67622299-67622321 TTGCTTATTACACATGTACCTGG - Intergenic
908817159 1:68046525-68046547 TTCACTATGTTACATGTACATGG - Exonic
910481382 1:87662146-87662168 TTCATTAGGATGCATCCACCAGG + Intergenic
911405938 1:97439826-97439848 TTCATTTTGATACATGCATTTGG + Intronic
912218925 1:107649923-107649945 TTCTTTATGATACTTTTATCTGG - Intronic
915445629 1:155973143-155973165 TTCATTTTGAGACATGTATTGGG - Intronic
915486432 1:156224474-156224496 TTCATTAAGAAACATTTATCAGG + Intronic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
916441585 1:164831266-164831288 TAGTTAATGATACATGTACCAGG - Intronic
916734218 1:167592860-167592882 TTCATGTTGATACAGGTAGCTGG - Intergenic
921794152 1:219323517-219323539 TTCATTATGCCACATGTGACAGG - Intergenic
921797940 1:219369593-219369615 TTCATTATCATTCACGTACAAGG - Intergenic
1066485222 10:35836824-35836846 TTGATTATGCAATATGTACCAGG + Intergenic
1067305917 10:45063997-45064019 TTGATTATGCAATATGTACCAGG + Intergenic
1068079597 10:52303527-52303549 TTTATTATTATACATTTACGTGG - Intergenic
1070447759 10:76524138-76524160 GTCATTATGATACATGGACTGGG - Intronic
1071168940 10:82840936-82840958 TACATTACGATACAGGTACTAGG - Intronic
1071928392 10:90437309-90437331 TCAATTCTGATACATCTACCTGG - Intergenic
1072256000 10:93620943-93620965 TTCAATATTGTACATGTAGCTGG - Exonic
1073944617 10:108735968-108735990 TTCATTATGAAATCTGTGCCAGG + Intergenic
1080014618 11:27491393-27491415 TTCCTTATGATCCATGGGCCTGG - Intergenic
1080713996 11:34780387-34780409 TTCATTTTTATCCATGTATCTGG + Intergenic
1084576134 11:69989086-69989108 TACATGATGATGCAGGTACCAGG - Intergenic
1087476012 11:98635821-98635843 TTGATCATGATACATGTTCATGG + Intergenic
1091440215 12:507065-507087 TTAATCATGACAAATGTACCGGG - Intronic
1094326864 12:29249908-29249930 TTCATTAAAATGCATCTACCTGG + Intronic
1095302155 12:40597480-40597502 TTCTTTATGATACATGTTCCTGG + Intergenic
1095548364 12:43400185-43400207 TTCAGCATGATATATGTACCAGG + Intronic
1095933132 12:47649246-47649268 TTCTTTATGCTTCATGTCCCCGG + Intergenic
1096026822 12:48373080-48373102 TTCAATAACATACATGAACCTGG + Intergenic
1100090313 12:90960424-90960446 TTAAATATGATACATTTAGCAGG + Intergenic
1100769414 12:97905249-97905271 TTCATTCTCATACATGCATCAGG - Intergenic
1102542709 12:113634217-113634239 ATGAATATGACACATGTACCTGG + Intergenic
1103545403 12:121697716-121697738 TTCATTAAGATACATTTATTTGG + Intergenic
1107769073 13:43770498-43770520 TTCATTGTAATACATTTCCCAGG - Intronic
1109485018 13:63007402-63007424 TTTATTATGGTATATATACCAGG + Intergenic
1111587080 13:90294710-90294732 TTCATTTTGATACATGTCCCTGG + Intergenic
1111890131 13:94071081-94071103 TTCATTCTGATACACATGCCTGG + Intronic
1112956266 13:105062272-105062294 TTCACTATTATCAATGTACCTGG - Intergenic
1116616651 14:47148987-47149009 TTCATTAAGATAAATGTGCCTGG + Intronic
1120308381 14:82799481-82799503 TTCATTATCAAACATCTGCCAGG + Intergenic
1123930528 15:25169417-25169439 TTCATAATGGTCCATGGACCCGG + Intergenic
1126374761 15:47985987-47986009 TTCATTATGTCATATGTACAGGG - Intergenic
1126428488 15:48555492-48555514 TTCATTTTGATATATGAAGCTGG - Intronic
1127418177 15:58777872-58777894 TACATTTTGATAAATTTACCTGG - Intronic
1127549940 15:60027073-60027095 CTCATTATTTTACATGTACAAGG + Intronic
1127729030 15:61781130-61781152 TCAATTATGATACAGGTATCAGG + Intergenic
1129569048 15:76659006-76659028 TTCATCATGAAATATTTACCAGG - Intronic
1131755091 15:95550833-95550855 TTCATTATGATCCGTGTCACTGG - Intergenic
1140175963 16:72660017-72660039 TAATTTATGGTACATGTACCTGG - Intergenic
1141251702 16:82364544-82364566 TTCATTGTGACAAATGTACCAGG - Intergenic
1145946305 17:28777460-28777482 TTCTTTATTATTCAGGTACCAGG + Intronic
1147165812 17:38592678-38592700 TACATGATGACACATGTGCCAGG - Intronic
1151040425 17:70853693-70853715 TTCTTTATGGTACATGTGCATGG + Intergenic
1155145659 18:23081320-23081342 CTCATTATGAGACAGGAACCAGG - Intergenic
1155990351 18:32273271-32273293 TTCATTAGGAAACACTTACCTGG + Intronic
1156046961 18:32887866-32887888 TACATTAAGAAAAATGTACCTGG - Intergenic
1156716991 18:40023575-40023597 TTCATTATGGGACATGTATTTGG + Intergenic
1157369480 18:47097518-47097540 TTCCTTGTGATACATGAAACTGG - Intronic
1159683540 18:71386745-71386767 TTCATTATTTTACATCTAACAGG + Intergenic
1163895885 19:20058740-20058762 TTCTTTATTATCCAAGTACCAGG + Intergenic
925853862 2:8110507-8110529 TTCCTTATGATACATCTATCTGG - Intergenic
927609193 2:24520529-24520551 TTGATTAAGATGCATGTTCCTGG - Intronic
927763382 2:25781477-25781499 TTCATTATTATTTATGTACATGG + Intronic
930396983 2:50834530-50834552 ATCATTATGATACATGAAACTGG - Intronic
933363128 2:81313707-81313729 TTCATTATGAAATATTTGCCAGG - Intergenic
933599520 2:84315619-84315641 CTCATTAAGACACTTGTACCAGG - Intergenic
940294353 2:152106818-152106840 TTAATTATGACAAATTTACCAGG + Intergenic
940436310 2:153660049-153660071 GTCACTATAATATATGTACCAGG - Intergenic
941084449 2:161100603-161100625 TCCTTAATGATACATGTGCCAGG + Intergenic
941922831 2:170869286-170869308 TACATTTTGATGCATGTATCTGG - Intergenic
943521403 2:188955049-188955071 ATCATAAGGATACAGGTACCAGG - Intergenic
944075289 2:195722773-195722795 TTCATAATGAAAAATGTAACAGG - Intronic
947332784 2:229047508-229047530 TTCATTATAATATAACTACCTGG - Intronic
1168945267 20:1749147-1749169 TTCATGATGAAATATTTACCAGG - Intergenic
1169777447 20:9271759-9271781 TTCTTTATAACACTTGTACCTGG + Intronic
1170448572 20:16457137-16457159 TTCATTTTGGTACATGTTCTGGG + Intronic
1170823168 20:19771374-19771396 TATATTATGAAACATATACCTGG - Intergenic
1175734132 20:61373488-61373510 TTCATTATGAGAAATGTAATGGG - Intronic
1177785343 21:25665439-25665461 TTCATTATGATGCTTGTATTAGG + Intronic
949486306 3:4542765-4542787 TCCATTATGATACTAGTGCCAGG - Intronic
951814028 3:26733056-26733078 TTCATCATGATAGTTGTTCCTGG - Intergenic
953131830 3:40146948-40146970 TTTATAATAATACATGTACTTGG + Intronic
956370028 3:68549358-68549380 TCCATTATGACACATCTACCTGG + Intergenic
956760057 3:72434250-72434272 TTCATACTAATACATATACCTGG - Intronic
958009048 3:87851690-87851712 TTCATTAGGATAGATGTTCAGGG - Intergenic
960216021 3:115038143-115038165 TTCATGATGATAAATGTCACAGG + Intronic
960355069 3:116641652-116641674 TTCATTAGGATACAATTAACAGG - Intronic
962225514 3:133603905-133603927 TTCATTAAGATAGATGAAGCTGG + Intronic
962727026 3:138239619-138239641 ATCATTATGATATATGTGCATGG + Intronic
964827148 3:160841043-160841065 ATCATTACAATACATGAACCTGG + Intronic
965085477 3:164090299-164090321 ATCATTATGCTAAATGTATCTGG - Intergenic
971432859 4:26586870-26586892 TTCATTATGATACATGTACCTGG - Intronic
975386102 4:73762298-73762320 TTCATCATGGAACATGGACCTGG + Intergenic
978539958 4:109805751-109805773 TTCATTATTCTACATTTACCAGG + Intergenic
981692063 4:147520307-147520329 TTTTTTATGATAAATTTACCAGG - Intronic
981888559 4:149709235-149709257 CTTAGTATGATACATTTACCTGG - Intergenic
981977675 4:150750295-150750317 TTGATTATAATCCATGTGCCAGG - Intronic
982879375 4:160692035-160692057 TTCATTATGAAATATTTTCCAGG - Intergenic
983261151 4:165458343-165458365 TTCAGTTTATTACATGTACCAGG + Intronic
984079227 4:175223152-175223174 TTCATTAAGACACATGGATCAGG + Intergenic
986305130 5:6508897-6508919 TTCACTCTGAGACATGTACATGG + Intergenic
987328718 5:16835871-16835893 TTTATTATGATCCATGTACTGGG - Intronic
988171009 5:27655533-27655555 TCCACTATGATACCTGTATCAGG - Intergenic
989734447 5:44686983-44687005 TTCATTATGAGACATGTGCATGG - Intergenic
989773915 5:45180133-45180155 TTCATTAAGTTACATGTTGCTGG - Intergenic
994319496 5:98375938-98375960 TTCATTAGGGGACATGTACAAGG - Intergenic
996612306 5:125396799-125396821 TTCATTATGATAGATGCAGAGGG - Intergenic
997386833 5:133480302-133480324 TTCACCATGAGACCTGTACCTGG + Intronic
998697819 5:144660542-144660564 TTCATCATTAACCATGTACCAGG + Intergenic
998923025 5:147091568-147091590 TTCATAATGATAAAGGGACCAGG - Intergenic
999851549 5:155545573-155545595 TTAATTCTGATAAATATACCAGG - Intergenic
1002934457 6:1659716-1659738 TTTATTATGATACATGGTCAGGG - Intronic
1006938672 6:37736784-37736806 TTTATTTTGAATCATGTACCTGG - Intergenic
1009441385 6:63683469-63683491 TTCCTTATGATACATTTGCTTGG + Intronic
1011979263 6:93351853-93351875 TTTATTCTAATAAATGTACCTGG + Intronic
1012592695 6:101002045-101002067 TTCATTTTGAGCCGTGTACCTGG + Intergenic
1012951466 6:105522269-105522291 TTCAATATTATAAATGTACGAGG - Intergenic
1013112858 6:107078377-107078399 TTCATTCTGATAAATGTAGAGGG + Intronic
1016994218 6:149949961-149949983 TTCATTATGATATCTTTGCCAGG - Intergenic
1017218283 6:151935959-151935981 TTCATTATGTAACATGAAACAGG + Intronic
1017882348 6:158570733-158570755 TTCATTTTGATAAATGCGCCAGG - Intronic
1021308848 7:19066916-19066938 GTCATTATGATACAGGAACCAGG + Intronic
1023020608 7:36008692-36008714 TTCATTAAGATATATGTGCAAGG - Intergenic
1024165009 7:46722361-46722383 TTAGTTCTGATGCATGTACCTGG - Intronic
1027558064 7:79691410-79691432 TTCTTTAGGATACATCTGCCAGG - Intergenic
1027584231 7:80037226-80037248 TTCCTTACGATACTTGTATCAGG + Intergenic
1028496302 7:91464622-91464644 TCCATCATGATACCTTTACCTGG - Intergenic
1030123449 7:106133151-106133173 TTCTTAATGATATAAGTACCTGG - Intergenic
1031035420 7:116783348-116783370 TTCTTTATCATACATGTCTCTGG - Exonic
1031104234 7:117520460-117520482 TTCATTGTGATGCATGTATGAGG + Intronic
1031476226 7:122225632-122225654 TGCATTTTTATACTTGTACCAGG - Intergenic
1031615241 7:123872011-123872033 TTCATTTTTATACATTTACAGGG + Intronic
1031755720 7:125639380-125639402 TTCATTATGCTAATTTTACCTGG + Intergenic
1031898249 7:127379512-127379534 TTAAATAGGATACATGTACATGG + Intronic
1033976226 7:147104094-147104116 TTCATTTTGACAAATGTGCCAGG + Intronic
1034380543 7:150688507-150688529 GTCACTATGACACATGTATCAGG + Intronic
1035446411 7:158946103-158946125 TTCATTAAGATACATTTTCATGG - Exonic
1036046600 8:5148576-5148598 TTCATGATCATAGAAGTACCAGG - Intergenic
1036168496 8:6460024-6460046 TTCATTGTGATTGTTGTACCAGG + Intronic
1036538485 8:9677089-9677111 TTCATTATGTTAGCTGTTCCTGG + Intronic
1037036254 8:14171221-14171243 TACATTTTGACACATGTATCAGG + Intronic
1040820980 8:51556893-51556915 TTCATTCTTATACAGGTACCTGG + Exonic
1040833814 8:51709681-51709703 TTAATTATGGTACATGAACATGG + Intronic
1042886732 8:73560510-73560532 ATCATTATGTTAAATGTAGCAGG - Intronic
1046323167 8:112604721-112604743 TTCATTATGAAACCTTTGCCAGG - Intronic
1047547756 8:125836265-125836287 TTCTTTATGATACATGTAAAAGG - Intergenic
1047746720 8:127850440-127850462 TTCTTTAGGATACCTGAACCAGG - Intergenic
1048616375 8:136079950-136079972 TTGATGATGATAAATGGACCAGG - Intergenic
1048666138 8:136663634-136663656 TTAATCATGATTCATGTAACAGG - Intergenic
1050742104 9:8833579-8833601 TTCAATATGAAAAATGGACCAGG - Intronic
1055117295 9:72619086-72619108 TTCAGTATGACAAATGTTCCAGG - Intronic
1059588421 9:115631206-115631228 TTCATTATTATTTATGTAGCTGG - Intergenic
1185907094 X:3945199-3945221 TTCATGTCGATACATGTACACGG + Intergenic
1186870753 X:13769324-13769346 TTCATTATAATAAAAGTAACTGG + Exonic
1187129323 X:16486949-16486971 TTCATTATGAAATCTGAACCAGG + Intergenic
1187384235 X:18832722-18832744 TTCATTAAGATTCATTTGCCCGG - Intergenic
1188898843 X:35703267-35703289 ATCATTATGATATAAATACCTGG - Intergenic
1193200158 X:78680028-78680050 TTCATTACAATATAGGTACCAGG + Intergenic
1195179930 X:102348255-102348277 TTCATCATGATATATTTTCCAGG + Intergenic
1199043818 X:143145941-143145963 TTCACCATTATACATGTACATGG + Intergenic
1201063153 Y:10066298-10066320 TTCATTGTGACACATGAATCCGG + Intergenic