ID: 971446712

View in Genome Browser
Species Human (GRCh38)
Location 4:26758139-26758161
Sequence TTTTATAAGAACAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971446712_971446715 26 Left 971446712 4:26758139-26758161 CCCTTCTCCTTGTTCTTATAAAA No data
Right 971446715 4:26758188-26758210 AGTATTAAGTGATAGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971446712 Original CRISPR TTTTATAAGAACAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr