ID: 971448757

View in Genome Browser
Species Human (GRCh38)
Location 4:26779980-26780002
Sequence GCTAGGTAAGGGCTTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971448751_971448757 14 Left 971448751 4:26779943-26779965 CCTGGCCTGTGGCAGAGTGGGAA No data
Right 971448757 4:26779980-26780002 GCTAGGTAAGGGCTTCCCTCTGG No data
971448750_971448757 15 Left 971448750 4:26779942-26779964 CCCTGGCCTGTGGCAGAGTGGGA No data
Right 971448757 4:26779980-26780002 GCTAGGTAAGGGCTTCCCTCTGG No data
971448748_971448757 16 Left 971448748 4:26779941-26779963 CCCCTGGCCTGTGGCAGAGTGGG No data
Right 971448757 4:26779980-26780002 GCTAGGTAAGGGCTTCCCTCTGG No data
971448752_971448757 9 Left 971448752 4:26779948-26779970 CCTGTGGCAGAGTGGGAAATCTT No data
Right 971448757 4:26779980-26780002 GCTAGGTAAGGGCTTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971448757 Original CRISPR GCTAGGTAAGGGCTTCCCTC TGG Intergenic
No off target data available for this crispr