ID: 971449155

View in Genome Browser
Species Human (GRCh38)
Location 4:26784033-26784055
Sequence CAGGGCTTCCAGGAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971449155_971449162 14 Left 971449155 4:26784033-26784055 CCTCCATCCTCCTGGAAGCCCTG No data
Right 971449162 4:26784070-26784092 TGAGATTTTTGGCCACTCAATGG No data
971449155_971449161 3 Left 971449155 4:26784033-26784055 CCTCCATCCTCCTGGAAGCCCTG No data
Right 971449161 4:26784059-26784081 ACTAATCTTGTTGAGATTTTTGG No data
971449155_971449163 20 Left 971449155 4:26784033-26784055 CCTCCATCCTCCTGGAAGCCCTG No data
Right 971449163 4:26784076-26784098 TTTTGGCCACTCAATGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971449155 Original CRISPR CAGGGCTTCCAGGAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr