ID: 971451239

View in Genome Browser
Species Human (GRCh38)
Location 4:26803907-26803929
Sequence AAAGAGAAGGGGACGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971451228_971451239 26 Left 971451228 4:26803858-26803880 CCTTCTGAACAAGAATCTTTACT No data
Right 971451239 4:26803907-26803929 AAAGAGAAGGGGACGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971451239 Original CRISPR AAAGAGAAGGGGACGGGGGA GGG Intergenic
No off target data available for this crispr