ID: 971452777

View in Genome Browser
Species Human (GRCh38)
Location 4:26815585-26815607
Sequence CATGTTACACACTCTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971452771_971452777 20 Left 971452771 4:26815542-26815564 CCAATAACCCTTACCAGGCTGGT No data
Right 971452777 4:26815585-26815607 CATGTTACACACTCTGAGAATGG No data
971452775_971452777 7 Left 971452775 4:26815555-26815577 CCAGGCTGGTGCCAAAACAGGTT No data
Right 971452777 4:26815585-26815607 CATGTTACACACTCTGAGAATGG No data
971452766_971452777 25 Left 971452766 4:26815537-26815559 CCTCCCCAATAACCCTTACCAGG No data
Right 971452777 4:26815585-26815607 CATGTTACACACTCTGAGAATGG No data
971452773_971452777 12 Left 971452773 4:26815550-26815572 CCTTACCAGGCTGGTGCCAAAAC No data
Right 971452777 4:26815585-26815607 CATGTTACACACTCTGAGAATGG No data
971452776_971452777 -4 Left 971452776 4:26815566-26815588 CCAAAACAGGTTCTGTGTTCATG No data
Right 971452777 4:26815585-26815607 CATGTTACACACTCTGAGAATGG No data
971452772_971452777 13 Left 971452772 4:26815549-26815571 CCCTTACCAGGCTGGTGCCAAAA No data
Right 971452777 4:26815585-26815607 CATGTTACACACTCTGAGAATGG No data
971452768_971452777 22 Left 971452768 4:26815540-26815562 CCCCAATAACCCTTACCAGGCTG No data
Right 971452777 4:26815585-26815607 CATGTTACACACTCTGAGAATGG No data
971452769_971452777 21 Left 971452769 4:26815541-26815563 CCCAATAACCCTTACCAGGCTGG No data
Right 971452777 4:26815585-26815607 CATGTTACACACTCTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971452777 Original CRISPR CATGTTACACACTCTGAGAA TGG Intergenic
No off target data available for this crispr