ID: 971455436

View in Genome Browser
Species Human (GRCh38)
Location 4:26839848-26839870
Sequence CAGTCTACACAGGTGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971455432_971455436 -8 Left 971455432 4:26839833-26839855 CCCATAGGCTGGCTGCAGTCTAC No data
Right 971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG No data
971455433_971455436 -9 Left 971455433 4:26839834-26839856 CCATAGGCTGGCTGCAGTCTACA No data
Right 971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG No data
971455427_971455436 14 Left 971455427 4:26839811-26839833 CCCGAGGCTCCAAACTCACATGC No data
Right 971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG No data
971455428_971455436 13 Left 971455428 4:26839812-26839834 CCGAGGCTCCAAACTCACATGCC No data
Right 971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG No data
971455430_971455436 5 Left 971455430 4:26839820-26839842 CCAAACTCACATGCCCATAGGCT No data
Right 971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971455436 Original CRISPR CAGTCTACACAGGTGAAGCT GGG Intergenic
No off target data available for this crispr