ID: 971456708

View in Genome Browser
Species Human (GRCh38)
Location 4:26851990-26852012
Sequence CAAGCTGGAGATTTAGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971456708_971456712 -1 Left 971456708 4:26851990-26852012 CCTAAATCTAAATCTCCAGCTTG No data
Right 971456712 4:26852012-26852034 GGGCTTTTCCTCTGAATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971456708 Original CRISPR CAAGCTGGAGATTTAGATTT AGG (reversed) Intergenic
No off target data available for this crispr