ID: 971456779

View in Genome Browser
Species Human (GRCh38)
Location 4:26852592-26852614
Sequence GACTTCTTGGTAAATTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971456779_971456790 28 Left 971456779 4:26852592-26852614 CCTTCAGAATTTACCAAGAAGTC No data
Right 971456790 4:26852643-26852665 GGAGTCTCACTCTGTCACCCAGG 0: 10947
1: 44694
2: 106698
3: 138738
4: 144268
971456779_971456786 7 Left 971456779 4:26852592-26852614 CCTTCAGAATTTACCAAGAAGTC No data
Right 971456786 4:26852622-26852644 GCCCCTTTTGTTTTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971456779 Original CRISPR GACTTCTTGGTAAATTCTGA AGG (reversed) Intergenic
No off target data available for this crispr