ID: 971457369

View in Genome Browser
Species Human (GRCh38)
Location 4:26857687-26857709
Sequence GCGCGGGGCTGCGGTGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971457360_971457369 9 Left 971457360 4:26857655-26857677 CCTGGGGGAAGCCGGCAGGAGGC No data
Right 971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG 0: 1
1: 0
2: 8
3: 75
4: 591
971457363_971457369 -2 Left 971457363 4:26857666-26857688 CCGGCAGGAGGCAGCGGGCATGC 0: 1
1: 0
2: 3
3: 39
4: 221
Right 971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG 0: 1
1: 0
2: 8
3: 75
4: 591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971457369 Original CRISPR GCGCGGGGCTGCGGTGGCGC AGG Intronic