ID: 971457369

View in Genome Browser
Species Human (GRCh38)
Location 4:26857687-26857709
Sequence GCGCGGGGCTGCGGTGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971457360_971457369 9 Left 971457360 4:26857655-26857677 CCTGGGGGAAGCCGGCAGGAGGC No data
Right 971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG 0: 1
1: 0
2: 8
3: 75
4: 591
971457363_971457369 -2 Left 971457363 4:26857666-26857688 CCGGCAGGAGGCAGCGGGCATGC 0: 1
1: 0
2: 3
3: 39
4: 221
Right 971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG 0: 1
1: 0
2: 8
3: 75
4: 591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971457369 Original CRISPR GCGCGGGGCTGCGGTGGCGC AGG Intronic
900091924 1:924403-924425 GAGCGGGGCTGCGGAGCCACCGG + Intergenic
900237509 1:1599838-1599860 GCGCGGGGCTGCGGAAGCACAGG + Exonic
900243803 1:1628747-1628769 TGGAGAGGCTGCGGTGGCGCCGG + Intronic
900293845 1:1938767-1938789 GGGCGGGGATGTGGTGGAGCTGG + Intronic
900414006 1:2526776-2526798 GCCCGGGGCTGCGGGCGGGCGGG + Intergenic
900524362 1:3121256-3121278 ACCCGGGGCTGCGGTGCCTCCGG + Intronic
900534108 1:3168572-3168594 GCGAGGGGCGGGGGTGGGGCGGG - Intronic
900581717 1:3412835-3412857 GGGCGGGGCCGCGGCGGTGCTGG + Intronic
900582489 1:3415929-3415951 GCTCCGGGCTGCGGAGGGGCTGG + Intronic
901183665 1:7358542-7358564 GCCCGGGGCAGGGGTGGCGCGGG - Intronic
901242871 1:7704964-7704986 GCGCGGGGCGGGGGCGGGGCCGG + Intronic
901243009 1:7705520-7705542 GGGCGGGGCTGGGGCGGCGTCGG + Intronic
901317214 1:8317358-8317380 GTGTGGGGCTGCAGAGGCGCTGG - Intergenic
901332768 1:8423730-8423752 GCGCGGGGCCCGGGGGGCGCGGG + Intronic
901500967 1:9652373-9652395 GAGCGGGGCTGCAGAGGGGCCGG + Intronic
901536367 1:9884916-9884938 GGGTGGGGCTGCGGTGGAACAGG + Intronic
903233993 1:21937634-21937656 GCGCGGGGAAGCGGGGGAGCCGG - Intergenic
903324740 1:22563449-22563471 GCCCGGGGCGGCGGCGGCGGCGG + Intergenic
903349992 1:22711420-22711442 GCGGGGGGCGGGGGGGGCGCCGG + Intronic
903455431 1:23484010-23484032 CCGAGGGGCGGCGCTGGCGCGGG - Exonic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
904006466 1:27365904-27365926 GCGCGGGGCTGTGGTGTCTCAGG - Intronic
904080951 1:27872419-27872441 GGGCGGGGCTTCGGCGGGGCGGG + Intergenic
904769069 1:32870914-32870936 CCGCGCGGCGGCGGTGGCGGCGG + Intronic
905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG + Exonic
905347083 1:37318597-37318619 GTGAGGGGCTGCGGCAGCGCGGG + Intergenic
905414383 1:37794390-37794412 GTGCGGGGCGGCGGCGGCGGCGG - Exonic
905441086 1:37996956-37996978 CCGCGGGGATGGGGTGGGGCAGG + Exonic
905580680 1:39081299-39081321 GCGGGGGGCGGCGTCGGCGCTGG + Intronic
905734566 1:40316650-40316672 GCCGGGGGCTGCGGGCGCGCGGG - Intronic
906032418 1:42732315-42732337 GCGGGGGGCGGCGGGAGCGCTGG - Intergenic
906365356 1:45205821-45205843 GCGGCCGGCTGCGGTGGCGAGGG - Exonic
906637013 1:47416488-47416510 GCCCGGGGCGGCGGCGGCGGCGG + Exonic
907947179 1:59146819-59146841 ACGCGGGCCAGCGGAGGCGCAGG + Intergenic
908128212 1:61050716-61050738 GCGCGGGGCGGGGGCGGCTCTGG + Intronic
908132057 1:61083362-61083384 GCGGGGGGCTGCGGCAGCGCAGG - Intronic
908796261 1:67833473-67833495 GGGCGGGGCGGCGGCGGCCCCGG + Intergenic
909632362 1:77780153-77780175 GCGAGGGGCTGCTGTGGGGTCGG + Intronic
912409043 1:109467072-109467094 TCGTGGGGCTGCGCTGGCGGCGG + Exonic
912441770 1:109704439-109704461 GTGAGGGGCTGCGGTGGGGGAGG - Intronic
912927898 1:113929700-113929722 GCGCGGGGCTGAGGCGGCGGCGG + Exonic
913959462 1:143327618-143327640 GCGCGGAGAGGCCGTGGCGCCGG + Intergenic
914009748 1:143766458-143766480 GCGCCGGGCTGCGGGCGGGCAGG + Intergenic
914053822 1:144153191-144153213 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
914125324 1:144813174-144813196 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
914197097 1:145453209-145453231 GGGCTGGGCTGCTGTGGCTCTGG - Intergenic
914703024 1:150150616-150150638 GGACGGGGCGGCGGGGGCGCAGG + Intronic
914803169 1:150974779-150974801 GCGGGCGGCGGCGGCGGCGCCGG - Exonic
915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG + Intronic
916484809 1:165249369-165249391 GGGCAGGGCTGCGGTGGGGTGGG - Intronic
916651770 1:166839902-166839924 GGGCGCGGCGGCGGTGGCGCAGG + Intronic
917838470 1:178959029-178959051 GCGGGGGGCAGGGGTGGCGGGGG + Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
918001642 1:180502597-180502619 GCGCGGGGCGCGGCTGGCGCTGG + Exonic
919826481 1:201506969-201506991 CCCCGGGGCTGCGGCGGGGCTGG + Intronic
920394189 1:205631859-205631881 GCACGCGGCAGCGGCGGCGCGGG + Exonic
921432792 1:215082998-215083020 GCGCGTGGCGGCGGCGGCGGCGG + Intronic
921603983 1:217135524-217135546 GCGCGCGGCGGCGGCGGCGGCGG + Intronic
922416478 1:225427579-225427601 GAGCCAGGCTGCGGTGGGGCAGG + Intronic
922917659 1:229271409-229271431 GCGGGGGGCGTCGGTGGCGCGGG + Intronic
922925128 1:229342153-229342175 GCGCGGGGCCCCGGAGGAGCAGG - Exonic
923086285 1:230705802-230705824 GGGCAGGGCCGCGGTGGCACGGG - Intronic
923490417 1:234478940-234478962 GCGCGCGGCAGCGGGGGCGCAGG - Exonic
923627213 1:235623753-235623775 GAGGGGGGCTGCTGTGGCGGAGG - Intronic
1062904341 10:1169800-1169822 GCACGGGGCTGTGGTGGTGAAGG - Intergenic
1063995089 10:11611521-11611543 GCGCGGCGCGGCGGCGGCGGCGG + Intronic
1064179186 10:13100177-13100199 GCGGGCGGCGGCGGTGGCGGAGG - Exonic
1064290606 10:14030893-14030915 GCCAGGGACTGCGGTGGGGCTGG - Intronic
1064645379 10:17454348-17454370 GCGCGGGGCTGCGGCCACGGCGG - Intergenic
1065092847 10:22252509-22252531 GCGCGGGGCTGGCGCTGCGCAGG - Intergenic
1065528105 10:26642971-26642993 GGGCGGGGCTGCCGTGGGGGCGG + Intergenic
1065549942 10:26860465-26860487 GCGCCGGGCTGCGGCAGCGGCGG + Intronic
1069698436 10:70404640-70404662 CCCCGGGGCTTCGGTGGAGCTGG - Intronic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1070147007 10:73781922-73781944 GGCCGGGGCTGCGGCGACGCTGG - Intergenic
1072591664 10:96832864-96832886 GCGTGGGGGAGGGGTGGCGCAGG - Intronic
1072783987 10:98268234-98268256 GCTCGGGGCTGGGGGGCCGCGGG - Exonic
1074121582 10:110497764-110497786 GGGCGGGGCAGCGGGGGCGAGGG - Intergenic
1074121647 10:110497993-110498015 CCGCGGGGCTGCGGCCGCGACGG - Exonic
1074818180 10:117159768-117159790 GCTCTGGGCTGGGGTGTCGCTGG + Intergenic
1074829985 10:117241316-117241338 GGGCGGGGCTGCGGGGACCCCGG + Intronic
1075697483 10:124447619-124447641 GCGGGGGGCGGCGGCGGCGGCGG - Exonic
1076035639 10:127196597-127196619 CCGCGGGGCGGAGGTGGGGCGGG + Intronic
1076371479 10:129958900-129958922 GCGGCGGGCGGCGGGGGCGCGGG - Intronic
1076394544 10:130129181-130129203 GCGCGGGGATGGGAAGGCGCGGG - Intergenic
1076605917 10:131689784-131689806 GTGCGGGGCTGAGCTGGGGCTGG - Intergenic
1076664214 10:132076938-132076960 GGGCTGGCCTGCGGTGGCCCCGG + Intergenic
1076685582 10:132197110-132197132 GGGCAGGGCTGCCGTGGGGCAGG + Intronic
1076721890 10:132396668-132396690 GCGCTGGGCTCTGGTGGCCCCGG - Intergenic
1076885914 10:133262163-133262185 GGGCGGGGCAGGGGTAGCGCGGG + Intergenic
1076890451 10:133280765-133280787 GTGCTGAGCTGGGGTGGCGCTGG + Intronic
1076993948 11:289371-289393 GTCCGGGGCTGCCGGGGCGCCGG - Intronic
1077008517 11:369980-370002 GCGGGGGGCGGGGGCGGCGCGGG + Intronic
1077052939 11:575927-575949 GGGCGGGGCTGCGGAGCAGCGGG + Intergenic
1077052987 11:576049-576071 GGGCGGGGCTGCGGGGGTGGGGG + Intergenic
1077065538 11:639563-639585 GCGCGGGGGCGCCGGGGCGCGGG - Intronic
1077216632 11:1397830-1397852 GAGCTGGGCTGGGGTGGGGCTGG + Intronic
1077285492 11:1763594-1763616 GCGCCGGGCTCCGGAGGTGCAGG - Intronic
1077322111 11:1947183-1947205 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1077360416 11:2138179-2138201 GGCCGGGGCTGGGGCGGCGCGGG - Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077474028 11:2778048-2778070 GCGCCGGCCTGCGGTGGTTCTGG + Intronic
1077496331 11:2888266-2888288 GCGCGGGGTTGGGGGGGCGGGGG + Exonic
1077545397 11:3167033-3167055 GGGTGGGGCTGGGGTGGAGCAGG + Intergenic
1077923161 11:6656003-6656025 GCGCGGCGCGGCGCTGGGGCCGG - Intergenic
1079689145 11:23400430-23400452 GCGGGGGGCTGCGGGGGTGAGGG - Intergenic
1081574185 11:44309211-44309233 GCGCTGGGCTGCGGGGCTGCGGG - Intronic
1081774055 11:45665709-45665731 GCTCGCGGCTGGGGCGGCGCGGG - Intergenic
1081863617 11:46347823-46347845 GAGCGGGGCGGCGGCGGGGCAGG + Intronic
1083264084 11:61538109-61538131 GCGAGGGCCTGCGGCGGCGGCGG - Intronic
1083323925 11:61863791-61863813 GCGCGGGGCTGCGGGGAGGCGGG + Intronic
1083487986 11:62995562-62995584 GGGCTGGGCTGTGGTGGCCCAGG + Intronic
1083572668 11:63768659-63768681 GCGCGGGGCCGCGGGGCCGGCGG + Exonic
1083684782 11:64369640-64369662 GCGGGGCGGAGCGGTGGCGCCGG + Intronic
1083740925 11:64711495-64711517 GGGCGGGGCTGTGGTGTCGGGGG - Intronic
1083883220 11:65558384-65558406 GCGCGGCGCGGCGGCGGCGAGGG + Intronic
1083886195 11:65574533-65574555 GGGCGGGGTTGAGGCGGCGCAGG + Intergenic
1083899201 11:65635585-65635607 GCTCGGGGTTGCGGTTGCGCAGG - Exonic
1084185595 11:67469244-67469266 GGGCGGGGCAGCGGCGACGCTGG - Intronic
1084257944 11:67955446-67955468 GCGCGGGGGTCCGGGGGTGCCGG - Intergenic
1084284165 11:68120942-68120964 GCGGGCGGCTGCGGCGGCGGGGG + Exonic
1084295763 11:68212956-68212978 GGGCGGGGCTGCGGCCGGGCCGG - Intronic
1084814814 11:71639783-71639805 GCGCGGGGGTCCGGGGGTGCCGG + Intergenic
1084946638 11:72642267-72642289 GCGCATGGCTGCGGCGGCGGCGG + Exonic
1085295663 11:75430320-75430342 GGCCGGGGCGGCGGCGGCGCTGG - Exonic
1086437988 11:86800477-86800499 GGGCGGGCCTCGGGTGGCGCGGG + Exonic
1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG + Intergenic
1091328572 11:134712612-134712634 GGGCGGGGCTGCGGAAGGGCGGG - Intergenic
1202805127 11_KI270721v1_random:2496-2518 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1092219083 12:6700660-6700682 GAGCGGGGCTGGGGGGTCGCAGG + Intronic
1092256137 12:6927832-6927854 GCGCGGGGCTGCGGACGGGCTGG - Intronic
1092429257 12:8396387-8396409 GCGCGGGGGTCCGGGGGTGCCGG - Intergenic
1092487435 12:8914636-8914658 GCGGGGAGCCGCGGTCGCGCCGG + Exonic
1092743250 12:11649917-11649939 GCGCGGGGCGGCGGGGGCGTGGG - Exonic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094025801 12:25958830-25958852 GCCCGCGGCGGCGTTGGCGCTGG + Intergenic
1094536084 12:31324167-31324189 GCGCCGGGCCGGGCTGGCGCGGG - Intronic
1094837574 12:34329326-34329348 GCGCGGGGCTGCGGTGATCCTGG - Intergenic
1096482413 12:51951576-51951598 GCGCGCGGCGGCCGCGGCGCCGG + Intergenic
1096774400 12:53955356-53955378 GCGGGCGGCGGCGGTGGCGACGG + Exonic
1096946737 12:55415005-55415027 GCGGGGAGCCGCGGTCGCGCCGG - Intergenic
1098029016 12:66235315-66235337 GCGCGGGGCAGCCTGGGCGCGGG + Intronic
1098106017 12:67069448-67069470 GCGGGGGGCTGCGGAGCCCCCGG + Intergenic
1101340748 12:103840629-103840651 GCGCGGGGCTGGGGTTCCTCAGG - Intronic
1101716664 12:107318526-107318548 CCGCGGAGCTGCGGCGGCGGCGG + Exonic
1101970720 12:109310084-109310106 GGGCGGGGCAGCGGCGGCGCGGG - Intergenic
1103527304 12:121577504-121577526 GCGCTGGGCTCCGGTGGTGAGGG - Intronic
1103749866 12:123151150-123151172 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1104001543 12:124863678-124863700 GCGCTGGGCTGCCGGGGCGCTGG - Exonic
1104733292 12:131120940-131120962 GAGCGGGGCTGGGGAGGGGCAGG + Intronic
1104895337 12:132161100-132161122 GGGAGGGCCTGCGGTGGAGCAGG - Intergenic
1104929181 12:132329297-132329319 GCCCGGGGCTGCGGGGGCTGCGG + Intronic
1104980175 12:132570135-132570157 CCGCGGGGCTGCGGGGGTGGCGG - Exonic
1105031495 12:132887432-132887454 CTGCGGGGCTGCGTGGGCGCGGG - Intronic
1105472069 13:20703735-20703757 GCTCGGGGCGGCGGCGGCGGCGG + Intronic
1105964527 13:25372322-25372344 GCCCGGGGCGGGGGCGGCGCGGG + Intronic
1106458477 13:29948099-29948121 GCGCTGGCCTGCGCTGGCGGTGG - Intergenic
1107371637 13:39756745-39756767 GCGGGGGGCGGCAGTGGCGGGGG + Intronic
1107467811 13:40665833-40665855 GGCGGGGGCTGCGGTGGCGCTGG + Exonic
1110630144 13:77698065-77698087 GTGCGGGGCGGCGGCCGCGCTGG - Intronic
1112504930 13:99969855-99969877 CCGAGGGGCTGCGGGCGCGCTGG + Intronic
1113082873 13:106535728-106535750 GCGCGCGGCCGCGGAGCCGCGGG - Intergenic
1113378929 13:109786103-109786125 GCGAGGGGCGGAGGGGGCGCGGG + Exonic
1113655605 13:112066655-112066677 GCGCGCGGCGGCGGCGGCGGCGG - Intergenic
1113803194 13:113096890-113096912 GTCTGGGGCTGCGGTGGCGTGGG + Exonic
1114474019 14:22981735-22981757 GCAAGGGGCTCCCGTGGCGCTGG + Exonic
1114522404 14:23347623-23347645 GGCCAGGGCTGCGGTGCCGCTGG + Exonic
1114648925 14:24271070-24271092 GCGCGGGCCTGCGGAGGTGAAGG + Intronic
1115545624 14:34462564-34462586 CCGCTGGGCTGCGGGGGCCCCGG - Intronic
1116835801 14:49768218-49768240 GAGCCGGGCGGCGGCGGCGCGGG - Exonic
1117135291 14:52729940-52729962 AGGCGGGGCTGCGGTGGGACAGG - Intergenic
1118285259 14:64465367-64465389 GCGCGGGGCGGCGCGGGCGCCGG - Intronic
1121308658 14:92923256-92923278 GGGTCGGGCTGCGGTGGCACCGG - Exonic
1122065997 14:99174899-99174921 GCGGGCGGCTGCGGGGACGCGGG - Exonic
1122128055 14:99589885-99589907 GGGCGTGGCTGCGGTGGAGGGGG - Intronic
1122130917 14:99604244-99604266 GGGCGGGGCGGCGGGGGCTCCGG - Intergenic
1122162296 14:99793299-99793321 TCGCGCGGCTGCGGCGGCGGCGG + Intronic
1122418211 14:101560478-101560500 GCGCGGGGCGGCGCCGGCCCCGG - Intergenic
1122582082 14:102777395-102777417 GGGCGGGGCGGCGGGCGCGCCGG + Intergenic
1122626094 14:103086028-103086050 GCGCCTGGCTGTGGTGGAGCAGG - Intergenic
1122645159 14:103189233-103189255 CCGCGGGGCTGCGGGGTCGAGGG + Intergenic
1122688779 14:103522000-103522022 GTGCGGGGCTGCGGGCGGGCCGG - Intronic
1122842495 14:104473258-104473280 GGGAGGGGCTGGGGTGGAGCTGG - Intergenic
1122904660 14:104796093-104796115 GCGCGGGGCGGGGGTGGCTTAGG + Intergenic
1122975254 14:105168330-105168352 GAGCGGGGCGGCGGGGGCGGCGG - Intronic
1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG + Intergenic
1123077868 14:105678332-105678354 CCGCGGGGCTGCGCTCGGGCTGG + Intergenic
1124612066 15:31215747-31215769 GCTCGGGGCGGCGGGGGCCCGGG - Intergenic
1124952660 15:34337904-34337926 GGGAAGGGCTGCGGCGGCGCGGG - Intronic
1125516632 15:40324407-40324429 GCAGGGGGCTCCGGAGGCGCCGG - Intergenic
1125674168 15:41493807-41493829 GCGCGGGCGTGCAGCGGCGCAGG + Intronic
1126738031 15:51751544-51751566 GCGCGCGGCTGCAGCGGAGCAGG - Exonic
1126823748 15:52529261-52529283 GCGCGAGGCGGCGGCGGGGCCGG - Intergenic
1127994769 15:64147105-64147127 GAGCTGGGCTGGGGTGGCGCAGG + Intergenic
1128056475 15:64703240-64703262 GGGCGGGGCGGCGGCGGCGGCGG - Exonic
1128344126 15:66842814-66842836 GCAGGGGGCGGCGGCGGCGCCGG + Intergenic
1128818862 15:70634343-70634365 GAGGGGGGCTGGGGAGGCGCTGG + Intergenic
1128841430 15:70854092-70854114 TCGCGGGACTGCGGCGCCGCCGG + Exonic
1128982490 15:72197659-72197681 GCGAGGGGCTGCTGCCGCGCGGG - Intronic
1129440655 15:75578857-75578879 GCCCCGGGCTGCTGAGGCGCGGG - Exonic
1129817244 15:78565710-78565732 GCGCGGGGCGATGGCGGCGCGGG + Exonic
1129853941 15:78811187-78811209 GCGCGGGGCTGCGGGGACTGGGG + Exonic
1130284619 15:82544624-82544646 TCAGGGGGCTGTGGTGGCGCAGG + Exonic
1130362963 15:83207689-83207711 GCGCGCGGCGGCGGCGGCGGCGG - Exonic
1130411726 15:83653838-83653860 GCGCGGGGCCGCGGCGACGGCGG - Intergenic
1131511320 15:93050982-93051004 GCGGAGGGCTGCGGGGGCACAGG + Intronic
1131517512 15:93089023-93089045 GGGAGGGGCTCCGCTGGCGCTGG + Intronic
1132056118 15:98650686-98650708 GCCAGGGTCTGCGGCGGCGCGGG + Intronic
1132251811 15:100340779-100340801 GCGCGGAGCTGGGGTTGCGTGGG - Intronic
1132499895 16:280613-280635 GAGCGGGGCGGCGGCGGGGCGGG + Exonic
1132741356 16:1414805-1414827 GCGCGGGGCTGGGGCGGGGCCGG - Intergenic
1132778906 16:1612446-1612468 GCGCGCGGCTGCGGGGGCTGCGG - Intronic
1132868010 16:2103383-2103405 TGGCGGAGCTGCGGTGGCCCCGG + Exonic
1132930629 16:2457343-2457365 GCACGGGGCTCTGGTGGGGCTGG - Exonic
1132947131 16:2537951-2537973 GCGCGGGGGCGGGGCGGCGCCGG + Exonic
1133042067 16:3066078-3066100 GCCCGGGGCAGGGGTGGGGCAGG + Intronic
1133126080 16:3646844-3646866 GGGCGGGGCTGAGGGGGAGCGGG + Intronic
1133269637 16:4604473-4604495 GGGTGGGGCTGCTGTGGCCCTGG - Intergenic
1133370052 16:5240119-5240141 GCGCGGGGGTCCGGGGGTGCCGG + Intergenic
1133768489 16:8854355-8854377 GCGGGGGGCTGGGGTGGTGGTGG - Exonic
1133784440 16:8963615-8963637 GGCCGGGGCTGCGGGGCCGCGGG + Intronic
1134121342 16:11586854-11586876 GCGCGGGGACGCCGGGGCGCGGG - Intronic
1134523763 16:14929740-14929762 TGGCGGAGCTGCGGTGGCCCCGG - Intronic
1134527791 16:14957762-14957784 GCGGGAGGCGGCGGCGGCGCAGG - Intergenic
1134615787 16:15650309-15650331 GCGCGGGGCTGGGGTCGGGGTGG + Intronic
1134711354 16:16328225-16328247 TGGCGGAGCTGCGGTGGCCCCGG - Intergenic
1134948222 16:18340357-18340379 TGGCGGAGCTGCGGTGGCCCCGG + Intergenic
1134955475 16:18380468-18380490 TGGCGGAGCTGCGGTGGCCCCGG + Intergenic
1136234066 16:28903788-28903810 GCAAGGGGCTGAGGGGGCGCGGG - Intronic
1136550488 16:30980005-30980027 GCGCGGGGCGGTGGCGGCGGGGG - Exonic
1136625323 16:31458760-31458782 GGGCGGGGCGGCGGGGGAGCGGG - Intronic
1136778978 16:32885563-32885585 GCGCGGGGCACCGGCGGCACCGG + Intergenic
1136891640 16:33975955-33975977 GCGCGGGGCACCGGCGGCACCGG - Intergenic
1137244692 16:46692869-46692891 GGGCGGGGCGGCGGTGGCGGTGG + Intronic
1137288778 16:47037740-47037762 GCGGGGGGCTCCGGAGGCGGCGG + Intergenic
1137926671 16:52547201-52547223 GGGCGGAGCGGCGGCGGCGCGGG - Intronic
1138196606 16:55056971-55056993 GCGGGCGGCGGCGGCGGCGCCGG - Intergenic
1139364862 16:66427117-66427139 GGGCGGGGCTGCGGCAGGGCAGG + Intergenic
1139410106 16:66751825-66751847 GCGCGGGGAGGCGGTGGCAGGGG + Intergenic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139489593 16:67279298-67279320 GCCCGGGGGTGCGGCGGGGCGGG + Exonic
1139750405 16:69106355-69106377 GCGCGGGGCTGCGCCGAGGCCGG + Intronic
1140033848 16:71358603-71358625 GCGCGGCGCGGCGGGGGCGGCGG - Intergenic
1141430552 16:83968565-83968587 GCGCGGGGAGGGGGTCGCGCGGG + Intergenic
1141430767 16:83969186-83969208 GCGAGGGGCTCCGGTCCCGCGGG - Intronic
1141553184 16:84819818-84819840 GCGGGGGGCAGCTGAGGCGCGGG - Intergenic
1141800399 16:86304119-86304141 GTGAGGGGCTGCGCTGGGGCTGG + Intergenic
1141840127 16:86568574-86568596 GCCCGGGGCCGCCGCGGCGCAGG + Exonic
1141989514 16:87602313-87602335 GCGCGGGGCTGGGGGCGCGGAGG + Intronic
1142126161 16:88411675-88411697 GCGGTGGCCTGAGGTGGCGCAGG + Intergenic
1142126791 16:88414456-88414478 GCCCAGGGATGCTGTGGCGCCGG + Intergenic
1142175484 16:88643239-88643261 GGGCGGGGCTGGGGTAGCGATGG - Intergenic
1142240686 16:88943474-88943496 AGGAGGGGCTGCGGTGGGGCAGG - Intronic
1142419917 16:89963912-89963934 GTGCGGGGATGCGGTGTGGCTGG + Intronic
1203081389 16_KI270728v1_random:1147652-1147674 GCGCGGGGCACCGGCGGCACCGG + Intergenic
1142611011 17:1109237-1109259 GCGCGAGGCGGCGGCGGCGGCGG - Intronic
1142611042 17:1109334-1109356 GCGCTGGGCTGCTGTGCGGCGGG - Intronic
1142699152 17:1649123-1649145 GGGCGGGGCTCCGGGGGCGGGGG - Intronic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1143063354 17:4222209-4222231 CCGCGGGGCGGCGGGGGCGGCGG - Intronic
1143099899 17:4499171-4499193 GCGCGGGGCGCGGGCGGCGCTGG + Exonic
1143223639 17:5282326-5282348 GCCCGCGGCTGTGGCGGCGCCGG + Exonic
1143746938 17:9002109-9002131 GCGGGGGGCGGTGGGGGCGCCGG - Intergenic
1143746953 17:9002143-9002165 GTGGGGGGCGGTGGTGGCGCAGG - Intergenic
1143958866 17:10697710-10697732 GGGCGGTGCTGCGGGGCCGCGGG + Intronic
1144109970 17:12021361-12021383 GCTCGGGGCTGCGGCGGAGCGGG + Intronic
1144695888 17:17303613-17303635 GCGCGGGGCGGCGGGCGGGCTGG + Exonic
1144775649 17:17783336-17783358 GGGCTGGGCTGCGGAGGCGGCGG + Intronic
1144784370 17:17823677-17823699 GGGCGGGGCTGGGGCGGGGCTGG - Intronic
1145063821 17:19748725-19748747 GCCCGGGGCAGCGGTGGCTGGGG - Intronic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1146008434 17:29176886-29176908 CCGCGGGGCTGCGGCTGCGCCGG - Intronic
1147168699 17:38606043-38606065 GCCCGGGGCGGCGGGGGCGGGGG + Intergenic
1147178860 17:38672924-38672946 GTGCGGGGCTGTGGTGGGGGTGG - Exonic
1147200645 17:38799425-38799447 GCCCGGGGCGGCGGCGGCGGCGG + Exonic
1147352740 17:39864303-39864325 GCGCGGGGTTACAGCGGCGCTGG + Intergenic
1147644857 17:42027527-42027549 TGGGGGGGCTGCGGTGGGGCAGG - Intronic
1147710317 17:42458832-42458854 GCGGGGGCCGGCGGCGGCGCAGG + Intronic
1148054814 17:44787659-44787681 CAGTGGGGCTGCGGAGGCGCTGG - Intergenic
1148148746 17:45383590-45383612 GCCAGGGGCTGGGGTGGCGTGGG + Intergenic
1148491284 17:48025338-48025360 GGGCGGGGCCGGGGTGGAGCCGG + Intergenic
1148591159 17:48817435-48817457 GCGCGGGGCTGCGGTGAGGGAGG + Intergenic
1149296414 17:55265707-55265729 GCGCGGGGCCGGGGCGCCGCGGG - Intronic
1150643533 17:66964823-66964845 GCGCGCCGCTCCGGGGGCGCCGG - Intergenic
1151724877 17:75878056-75878078 GGGCGGGGCTGCGCTCGTGCGGG + Exonic
1151780005 17:76239812-76239834 GAGCGGGGCTGCGGCGTCGTAGG - Intronic
1151783787 17:76265440-76265462 ACGCGGGGCTGCGCGGGCGCGGG - Exonic
1152049225 17:77959215-77959237 CCGCGGGGCTCCGGTGGCGCGGG - Intergenic
1152457292 17:80423673-80423695 TGGCGGGGCTGTGGTGGCCCTGG + Intronic
1152628649 17:81399793-81399815 CAGCGGCGCTGCGGTGGCCCAGG - Exonic
1152628853 17:81400585-81400607 GCGCGGGCTGGGGGTGGCGCGGG + Intronic
1152654211 17:81512576-81512598 GGACGGGGCTGGGGGGGCGCCGG - Exonic
1152729194 17:81961467-81961489 GCGGGGGGGGGCGGCGGCGCCGG - Intronic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG + Exonic
1153006228 18:500650-500672 GCGCGGGCCGGCGGCGGCGAGGG - Exonic
1153402053 18:4692020-4692042 CAGCGGGTCTGCGGTGGCGGCGG - Intergenic
1153514453 18:5891255-5891277 CCCGGGGGCTGCGGTGGCTCCGG - Exonic
1154216607 18:12420649-12420671 GCGCGGGGTGGGGGTGGCGGTGG + Intronic
1157614009 18:48976178-48976200 GAGCGGGGCGGCGGCGGCGGCGG + Intergenic
1157736617 18:50055222-50055244 GGGCGGGGGTGAGGTGGGGCAGG - Intronic
1159489074 18:69106207-69106229 GCGCTGGAGTGCGGTGGCGCTGG + Intergenic
1159489076 18:69106223-69106245 GCGCTGGAGTGCAGTGGCGCTGG + Intergenic
1159798101 18:72867774-72867796 GCGGGCGGCGGCGGCGGCGCCGG + Exonic
1160417599 18:78721775-78721797 GCGCGGGGCTGCCGCGGAGTGGG - Intergenic
1160454987 18:78993622-78993644 GCGGCTGGCTGGGGTGGCGCTGG - Exonic
1160499715 18:79395745-79395767 GCGAGCGGCTGCCGCGGCGCGGG + Intergenic
1160689841 19:456430-456452 GCGAGGGACGGCGGTGGCCCAGG - Intronic
1160738955 19:677217-677239 GCGCAGGGCTGGGGTGGGGTGGG - Intronic
1160930620 19:1568094-1568116 GCGGGCGGCGGCGGCGGCGCGGG - Intergenic
1160930665 19:1568192-1568214 GGGCGGGGCGGCGGCGGCGCGGG + Intergenic
1161072348 19:2269269-2269291 GGGCGGGGCTGCCGTGGCGCCGG - Intronic
1161074894 19:2280808-2280830 GCCCTGGGCTGCGGGGGTGCAGG - Intronic
1161101817 19:2425276-2425298 GCCCGGGGCCGCGGTGGTGCGGG + Intronic
1161114612 19:2489461-2489483 GCCTGGGGCCGCGGTGGCACAGG + Intergenic
1161250379 19:3276678-3276700 GGGCGGGGCTGCGGTGGGGTGGG + Intronic
1161450643 19:4343633-4343655 GCGCGGGGCTGCAGGGGCGCGGG + Intronic
1161450646 19:4343649-4343671 GCGCGGGGCTGCAGAGCCGTGGG + Intronic
1161450713 19:4343878-4343900 GCGGGGGGCTGCGGCGGGCCCGG + Exonic
1161461546 19:4400503-4400525 GCGAGCGGCTGAGGCGGCGCCGG - Exonic
1161471267 19:4457717-4457739 GCGGGGGGCCGCGGGGGCGGGGG + Exonic
1161688949 19:5719822-5719844 GCGGGGGGCAGCGCGGGCGCCGG - Exonic
1161954053 19:7483108-7483130 GGGCGGGGCTCCGATGGGGCGGG - Intronic
1162027707 19:7903917-7903939 GTGCGCGGCGGCGGTGGCGGCGG + Exonic
1162060485 19:8091691-8091713 GCCAGGGGCTGCAGTGGGGCTGG + Intronic
1162175374 19:8826238-8826260 GCACGGGGCGGCAGTGGGGCTGG + Intronic
1162378908 19:10320827-10320849 GCCCGGGGCTGGGGAGGCGCCGG - Exonic
1162421558 19:10568680-10568702 GCGCCGGGCTGGGGCGGGGCGGG - Exonic
1162591981 19:11597821-11597843 ACGCGGGGCTGCGGGGCCGCAGG - Intronic
1162700810 19:12513512-12513534 ACGCGGGGCTGCGGTCGCCACGG + Intronic
1162722148 19:12668986-12669008 GAGTGGGGCTGCGATGACGCTGG - Intronic
1162959494 19:14117623-14117645 GCGCTGGGCGGCGGCGGCGGCGG + Exonic
1163441297 19:17323822-17323844 GCGCGGGGCTCCGGCTGCGGCGG + Exonic
1163507925 19:17719395-17719417 GGGCGGGGATGCGGTGGTTCCGG + Exonic
1163547295 19:17947972-17947994 GGGCGGGGCCGCGGGGCCGCCGG + Intergenic
1163635982 19:18437451-18437473 GCGAGGGGCTGCAGGGGCGAGGG - Intronic
1163728057 19:18933521-18933543 GCACTGGGCTGCGGTGGCGCTGG - Intronic
1163790898 19:19305649-19305671 GGGCGGGGCTGGGGTGTTGCTGG - Intronic
1164160494 19:22623104-22623126 GGGCGGGGCTGGGGTGTCGGGGG + Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1165309916 19:35023571-35023593 GCTCGGGGCTGCGGGGCTGCAGG + Intronic
1165349521 19:35268519-35268541 GCGCGCGGCGGCGGCGGCGGCGG - Intergenic
1165392354 19:35545832-35545854 GCGCGGGGCGGAGAGGGCGCGGG + Intronic
1165458734 19:35931539-35931561 GGGCGGTGCTGCGCAGGCGCGGG - Intergenic
1165510970 19:36266527-36266549 GACCGGGGCGGCGGTGGCGGCGG - Intergenic
1166083270 19:40458311-40458333 GCCGGGGGCGGGGGTGGCGCTGG + Intronic
1166529553 19:43534372-43534394 GCGCGGGGCGGGGGTGACGCCGG - Exonic
1166791705 19:45402631-45402653 GCGGGGCGCGGGGGTGGCGCGGG + Intronic
1167080791 19:47274978-47275000 GCGAGGGCCCGCGGGGGCGCTGG + Exonic
1167358512 19:49017935-49017957 GGGCGGGTCTGGGGTGGGGCTGG + Intergenic
1167456151 19:49597462-49597484 GCGGGAGGCGGCGGTGGCGGAGG - Exonic
1167633490 19:50639820-50639842 GCGCGGGGCTGCGGCGGCGGCGG - Intronic
1167797548 19:51719649-51719671 GCGGGTGGCGGCGGCGGCGCGGG - Exonic
1167991578 19:53365567-53365589 GGGCGGGGCTGGGCTGGGGCGGG - Intergenic
1168304746 19:55429387-55429409 GTGCGGGGCTGGGGAGGCCCTGG + Exonic
1168408063 19:56120998-56121020 GCGCGCGGCCGGGGTGACGCGGG - Intronic
1202693298 1_KI270712v1_random:105849-105871 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
925069617 2:956225-956247 GGGCGGGGCAGGGGTGGGGCAGG - Intronic
925976063 2:9142921-9142943 TCGCGGGGCAGAGGCGGCGCCGG - Intergenic
926077129 2:9951038-9951060 GCGCGCGGCCGCGGTGGGCCAGG + Intergenic
926154955 2:10448470-10448492 GCGCGGAGCTGGTGGGGCGCCGG + Exonic
927213198 2:20651115-20651137 GGGCGGGGACGCGGTGACGCGGG - Intergenic
927542583 2:23926577-23926599 GCCGGGGGAAGCGGTGGCGCCGG - Exonic
927552141 2:24010078-24010100 GGGCGGCGCTGCGGTGGCAATGG + Exonic
927709057 2:25314012-25314034 GCGCGGGGCTGGGGGGCTGCTGG + Exonic
927836345 2:26402103-26402125 GCGCAGCGATGCGGAGGCGCCGG - Exonic
927964972 2:27262833-27262855 CCCCGGGACCGCGGTGGCGCCGG - Exonic
928089196 2:28363738-28363760 GAGAGGGGCTGCGGTGCCCCAGG - Intergenic
928998848 2:37325291-37325313 GCGCCGAGCTGCGGTGCCGGCGG - Intergenic
929778336 2:44942216-44942238 GCGGGAGGCGGCGGCGGCGCGGG + Exonic
930411234 2:51028274-51028296 GCTCGGGGCTGGGGTGCGGCGGG + Exonic
931321348 2:61177324-61177346 GCGCGGGGACGCGGGGACGCGGG - Intergenic
932245198 2:70190872-70190894 GACCGGGGCGGCGGTGGGGCAGG - Intronic
932486978 2:72090226-72090248 GGGCGGGGGTGGGGTGGCGGGGG - Intergenic
933666713 2:84970829-84970851 GCGCGGCGCGGCGGCGGCGGCGG + Intergenic
933953270 2:87348710-87348732 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
934237501 2:90245055-90245077 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
934275689 2:91571610-91571632 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
934566978 2:95346603-95346625 GCGCGGGGGCGCGGCGGCGGCGG - Intronic
934946833 2:98548377-98548399 GTGCAGAGCTGCGGTGGCACAGG - Intronic
935112344 2:100104911-100104933 GCGCGGGGCGGGCGCGGCGCGGG - Intronic
935137727 2:100322096-100322118 CCGCGGGGCTGCGACGACGCGGG + Exonic
935820155 2:106886430-106886452 GCGCGGAGCAGCGCTGGCCCCGG - Exonic
936954999 2:118014196-118014218 TCCCCGGGCTGCTGTGGCGCAGG - Intergenic
938014748 2:127858091-127858113 GCGCGGCGCGGCGATGGCGGCGG - Exonic
938064885 2:128276497-128276519 GTGTGGGGCTGGGATGGCGCTGG + Intronic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
939153801 2:138501747-138501769 GCGCGCGGCGGCGGCGGCGGCGG - Intergenic
940009518 2:149038941-149038963 TCGCGGGGCCGCGGGGCCGCGGG + Intronic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
941095856 2:161238901-161238923 GCGGGTGGCGGCGGCGGCGCGGG - Intergenic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
942890273 2:180980310-180980332 TCGCGGGGCCGCTGTGCCGCGGG - Intronic
945209611 2:207368621-207368643 GCGGGGGGCTGCAGTGTTGCTGG - Intergenic
947549899 2:231038225-231038247 GCGCGGGCGGGCGGTGGCTCGGG + Intronic
947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG + Exonic
948116037 2:235494634-235494656 GCGCGGGGCGGCGGCGGCGGGGG + Exonic
948213856 2:236214614-236214636 GCGCGCTGCTGCTGCGGCGCGGG - Exonic
948272848 2:236687535-236687557 GCTGGGGGCTGCTGTGGGGCTGG - Intergenic
948473645 2:238203144-238203166 GCGGGGGCCCGCGGTGCCGCCGG + Intronic
948824683 2:240568506-240568528 GCGCCGGGCGGCGGCGGCGGCGG - Intronic
948874380 2:240819308-240819330 GGGAGGGGCTGCGGGGCCGCAGG - Intronic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
949014529 2:241702016-241702038 GCGCGGGCGGGCGGTGCCGCGGG - Intronic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079863 2:242088459-242088481 GCGCGGGGGGGCGGGGGCGGGGG - Intergenic
949079869 2:242088467-242088489 GCGCGGGGGCGCGGGGGGGCGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1168795883 20:610041-610063 GCGGGCGGCGGCGGCGGCGCGGG - Exonic
1168819001 20:761121-761143 GTGCGGGGCGGCGGTGCAGCTGG - Exonic
1169486861 20:6041547-6041569 GCGCGGAGCTGCAGAGGCGGTGG - Exonic
1170756840 20:19212575-19212597 GCGCCGGGAGGCGGCGGCGCGGG + Intergenic
1171013810 20:21522638-21522660 GCGGGCGGCTGCGGAGTCGCGGG + Intergenic
1171034283 20:21703721-21703743 GCTCGGGGCTCCGGGGGTGCGGG - Intergenic
1171810638 20:29742744-29742766 GCGCGGGGCCGCCTTGGTGCTGG - Intergenic
1172028953 20:31968262-31968284 GCGCGGGGAGGCGGCGGCGGCGG + Exonic
1172083224 20:32358689-32358711 GCGCGGGGCTGGGGCGGCGGCGG - Exonic
1172618620 20:36306191-36306213 GCGCGGGGCTGGGGGGGCCTTGG - Intergenic
1172974159 20:38894111-38894133 GGGCGGGGGTGCGGGGGTGCGGG - Intronic
1173528368 20:43749972-43749994 GCGGGCGGCTGGGGTGGCGCTGG + Intergenic
1173736145 20:45363107-45363129 GGGCGGGGCTGAGGTTGCGCAGG - Exonic
1174573825 20:51523412-51523434 GCGAGGGGCTCCGGGAGCGCTGG + Exonic
1175199084 20:57265972-57265994 GCTCCTGGCTGCGGAGGCGCCGG + Exonic
1175215826 20:57391338-57391360 GGGCGGGGCTGAGCTGGCGGGGG + Intergenic
1175439620 20:58981456-58981478 GCGCGAGGCTGCGGGCGTGCGGG + Intronic
1175715500 20:61252393-61252415 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1176128961 20:63488211-63488233 GCGCGGGGCGGGGGCGGGGCGGG + Exonic
1176249904 20:64115659-64115681 GCACGGCTGTGCGGTGGCGCAGG + Intergenic
1176281625 20:64316745-64316767 GCGGGGCGCGGCGGGGGCGCGGG + Intergenic
1178314882 21:31559302-31559324 GCGCGCGGCTGGAGGGGCGCGGG + Intronic
1178329046 21:31671294-31671316 GCGCGGGGCTGCAGTACAGCGGG + Exonic
1178417090 21:32412738-32412760 GCGGGGGGCCGCGGAGCCGCTGG + Exonic
1178417110 21:32412823-32412845 GCGCGGCGGGGCGGAGGCGCAGG - Exonic
1178948489 21:36966893-36966915 GCGAGGGGCAGCGCTGGGGCGGG + Intronic
1179511844 21:41878889-41878911 GCGCGGGGCCGCGGGGCTGCCGG - Intronic
1179926008 21:44534236-44534258 GGGCGGGGCTGGTGTGGGGCGGG + Intronic
1179977047 21:44874076-44874098 GCGCGGTGCTTCGGTGGCGGAGG + Intergenic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180021032 21:45127145-45127167 GGGAGGGGCTGTGGTGGAGCTGG + Intronic
1180960575 22:19760671-19760693 GCGCGGGGGTGGGGGGGCCCCGG + Intronic
1181745452 22:24952691-24952713 GCGCGGGGCTGCGGGCTCCCAGG + Intergenic
1181855379 22:25777685-25777707 GCCCTGGGCTGGAGTGGCGCTGG + Exonic
1182586343 22:31346160-31346182 GCGCACGGGGGCGGTGGCGCGGG + Exonic
1183373492 22:37449030-37449052 GTGCTGGGCTGCGGGGGCGGAGG - Intergenic
1183444476 22:37844084-37844106 GCGCTGGGCGGCGGCGGCGCGGG - Exonic
1183535623 22:38398929-38398951 GCGCGGGGGCGGGGTGGGGCGGG - Intergenic
1183546035 22:38455288-38455310 GCGCGGGGGTCCGGGGGCCCGGG + Intergenic
1183553225 22:38505688-38505710 CCGCGGGGCTGGGATGGGGCCGG + Intronic
1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG + Exonic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1183955991 22:41381308-41381330 GTGCGGGGCTGTGGCGGGGCGGG - Intronic
1184035050 22:41914275-41914297 CCGGGGCGCTGCGGTGTCGCGGG + Exonic
1184153049 22:42649426-42649448 GCGCGGGGCGGGGCGGGCGCGGG + Intronic
1184347719 22:43923751-43923773 GGGCGGGGCTGACGTCGCGCTGG + Exonic
1184547796 22:45183926-45183948 GGGCAGGCCTGCGGTGGAGCGGG + Intronic
1184858602 22:47160550-47160572 GGACGGGGCTGGGGAGGCGCAGG - Intronic
1185192068 22:49444980-49445002 GCCCGGTGCTGCGGAGGAGCGGG + Intronic
1185222409 22:49635800-49635822 CCGCGGGGCTGGGGTGCTGCAGG + Intronic
1185272694 22:49936094-49936116 GCGCGGGGCCGGGGCGGCGGGGG - Intergenic
1185296710 22:50058304-50058326 GCGTGGGGCTGCGCGGGCGGCGG + Intergenic
1185369713 22:50455449-50455471 GCGTGGGGCTGGGGTGGGCCAGG - Intronic
1203255058 22_KI270733v1_random:133692-133714 GCGCGCGGCGGCGGCGGCGGCGG + Intergenic
1203263114 22_KI270733v1_random:178771-178793 GCGCGCGGCGGCGGCGGCGGCGG + Intergenic
950549055 3:13655400-13655422 GCGCCGGGCGGCCGGGGCGCCGG - Intergenic
950578590 3:13847791-13847813 GCCAGGGGCTGGGGTGGGGCGGG + Intronic
950821878 3:15768652-15768674 GCGGGGGGCGGCGGTGGGGCAGG + Intronic
951558697 3:23945500-23945522 GCGCGGCGCTGAGGCGGCGGCGG + Exonic
951566695 3:24018989-24019011 GCCAGGTGCTGCGGTGGGGCAGG + Intergenic
952418951 3:33114329-33114351 GCGCGGCGCTGCAGTTGCGGTGG - Exonic
952799511 3:37275571-37275593 GCCCGGGCCTGCGGTGGTGGGGG + Intronic
953614441 3:44477623-44477645 ACGGGCGGCTGCGGTGGCGGCGG - Intronic
953627739 3:44584846-44584868 GCGCGGGGCTTCTGAGGGGCGGG + Intronic
953705074 3:45225218-45225240 GGGGGTGGCTGCGGTGGTGCTGG + Exonic
954131396 3:48562929-48562951 GGGTGGGGCTGCAGTGGCTCTGG + Exonic
954409690 3:50365026-50365048 GCGCGGGGCAGAGGGGGAGCGGG + Intronic
954660127 3:52222566-52222588 GGGCCAGGCTGAGGTGGCGCAGG + Exonic
954702044 3:52455609-52455631 GCGCCGGGCGGCGGTGGCGGCGG + Exonic
954882638 3:53846173-53846195 GCGCGGGGCGCCGGCGCCGCCGG - Exonic
956628029 3:71286303-71286325 GGGCGGGGCGGGGGTGGCGGGGG - Intronic
958798707 3:98732798-98732820 GCGCGGGCCAGGGGCGGCGCGGG - Exonic
961692663 3:128681153-128681175 ACGCGGGGCTGCGGAGGCGGCGG + Intergenic
961735811 3:129001616-129001638 GCGCGGCGCAGCGATGGAGCCGG + Exonic
962793944 3:138834858-138834880 GTGCGGCGCTGCGGCGGAGCGGG - Intronic
963091494 3:141487259-141487281 GCGCGAGGCTGAGGGGGCGGCGG + Intronic
963121276 3:141778710-141778732 GCGAGTGGCTGCAGTGACGCTGG + Exonic
963503848 3:146161023-146161045 GCGCGGCGCTGCGGGGCCGTGGG - Exonic
964482792 3:157159619-157159641 GCGGGGGGCTGCGGAGGCGGAGG - Intronic
965597055 3:170419959-170419981 CTGCGGGGCTGCGGTGACGCCGG + Intronic
966696286 3:182793543-182793565 GCGCCGGGCGGGGGCGGCGCCGG + Exonic
966808762 3:183825637-183825659 GGGCGGTGCTGCGGCGGCGCGGG - Intergenic
966866542 3:184261513-184261535 GCGGGGGGCGGGGGTGGCGGCGG + Intronic
968186053 3:196634259-196634281 GTGCGGGGGTGGGGTGGGGCTGG - Intergenic
968258176 3:197297952-197297974 CCGCGGGGGTGCGGCGGCCCAGG - Intronic
968382431 4:107875-107897 GCGCTGGGCTCCGGGCGCGCGGG + Intergenic
968434127 4:576251-576273 GCGCGGGGTCGCGGCGGCGGCGG - Intergenic
968615938 4:1577919-1577941 GTGAGGGGCTGCGGGGGTGCAGG + Intergenic
968625068 4:1623336-1623358 TCCCGGGGCTGCGGTGGGGGTGG - Intronic
968652293 4:1765018-1765040 GCGGGGGGCTGCTATGGGGCTGG + Intergenic
968652471 4:1765720-1765742 GCCCAGGGCTGAGGTGGTGCAGG - Intergenic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
968965149 4:3765926-3765948 GCGCAGGGCGGCGGCGGCGGCGG + Intergenic
969016485 4:4107244-4107266 GCGCGGGGGTCCGGGGGTGCCGG - Intergenic
969239204 4:5888197-5888219 GCGCGGGGCGGCGGGGGCGGGGG + Intronic
969240351 4:5893055-5893077 GTGCGGGCCTGCGGCGGCCCGGG + Exonic
971351815 4:25862618-25862640 GCGCGGGGCCCCGGGGACGCGGG - Intronic
971351870 4:25862801-25862823 GCGCGGGGCTCGGGTGGCCGCGG - Exonic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
971804345 4:31336006-31336028 GCGGGGGGCTGCGGGGGCAAGGG + Intergenic
972322099 4:37981569-37981591 GCTCCGGGCTGGGGTGGTGCAGG + Intronic
972396570 4:38663866-38663888 GCGCGGCGCGGCCGTGGGGCTGG - Intergenic
972396614 4:38663975-38663997 GGGCGGGGCGGAGGCGGCGCGGG + Intergenic
973820619 4:54658735-54658757 GCGTGGGGCTGTTGTGGGGCCGG + Intronic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
975986050 4:80202423-80202445 GCGGAGGGCGGCGGTGGCGCTGG + Exonic
976068335 4:81215032-81215054 GCGCTGGGCTCCGGCGCCGCAGG - Exonic
977607223 4:98995553-98995575 GCGCGGGGCGGGGGCGGGGCCGG + Intergenic
978777060 4:112515292-112515314 GCGCGGGGCTGAGGCCGGGCAGG - Exonic
978778358 4:112524102-112524124 CCGCGGGGCTTCGGGGCCGCGGG + Intergenic
980913756 4:139015951-139015973 GCGAGGGGCCGTGGTGGCGGCGG + Exonic
984734956 4:183099691-183099713 GCGGGGGGCTGGGGCGGCGCCGG + Intronic
984972539 4:185203905-185203927 GCGTGGGGCTGTGGTGGCCGCGG - Exonic
985128930 4:186723259-186723281 GCGCGGGGCTGCCGGGTCCCTGG - Intronic
985574301 5:666428-666450 GGGCGGGGCTGTGGTGGCCCCGG - Intronic
995724812 5:115170830-115170852 CCGCGGGGGTGCGGGGGTGCCGG - Intronic
996738306 5:126777066-126777088 GCGGGGGGCGGAGGTGGCGCGGG - Intronic
996862652 5:128083708-128083730 CGGCGGGGCTGCGGCGGCGGCGG - Intergenic
997246831 5:132356878-132356900 GCGGGGGGCTGGGGTGGTGGTGG + Intergenic
997265169 5:132490981-132491003 GGGCGGGCCCGCGGTGGCCCCGG - Intergenic
998166671 5:139848284-139848306 GCGCGCGGCCGCGGCGGCGGCGG + Exonic
999294895 5:150453055-150453077 GCGCAGGGGTGCGGTGGGGTGGG - Intergenic
1000209106 5:159095207-159095229 GCGAGGGGCTGAGGGGGCGGAGG - Intronic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1002091672 5:176810152-176810174 GCCCGGGGCTGCGGCGACCCCGG - Intergenic
1002280304 5:178125831-178125853 GCCAGGGGCTGGGGTGGGGCGGG - Exonic
1002601223 5:180354814-180354836 GGGCAGGGCTGCGCTGGTGCAGG + Intergenic
1002895679 6:1378810-1378832 GCGCGTGGCTGCCGCGGCGCCGG - Intergenic
1002934275 6:1658415-1658437 GCGCTGGGCTGTGTGGGCGCAGG - Intronic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003290677 6:4776282-4776304 GGGCGGGGCGGCGGCGGGGCGGG - Intronic
1004272949 6:14211360-14211382 GCGGGAGGCTGCGCTGGCACCGG - Intergenic
1004690288 6:17987530-17987552 GCGCGCGGCTGCAGCGGCGGCGG - Exonic
1005289022 6:24360153-24360175 GCGCGAGGCTGCGGTTGCTATGG - Intergenic
1005385199 6:25279123-25279145 GTGCGGTGCTGCGGTGGCGGCGG - Intronic
1006137145 6:31902042-31902064 GCGCGCGGCGGCGGCGGCGTCGG + Intronic
1006170127 6:32087627-32087649 GGGCGGGGGTGCGGGGGAGCCGG + Intronic
1006642453 6:35496381-35496403 GCGCGGTGCCGCGGCTGCGCTGG - Intronic
1006717527 6:36130256-36130278 GCGCGGGCCAGCGGCGGGGCTGG - Intronic
1007739634 6:44002763-44002785 GCGCGCGGCGGCGGCGGCGGCGG + Exonic
1007937068 6:45741890-45741912 GGGCGGGGCTGGGGTGGAGAAGG - Intergenic
1008276672 6:49550903-49550925 GCGCGGGGCTCCGCTAGCTCCGG + Exonic
1010032911 6:71288897-71288919 GCGCGGGGCTGCGGGGCTGCGGG - Exonic
1010083066 6:71886626-71886648 GCGCGGGGCGGGGGCGGGGCTGG - Intergenic
1010703455 6:79078342-79078364 GCGCCGGGGGGCGGGGGCGCGGG - Intergenic
1010863836 6:80947659-80947681 GGGCGGGGGTGGGGTGGCGGTGG - Intergenic
1012401178 6:98843781-98843803 GCGCAGGTCTGTGCTGGCGCCGG + Intergenic
1012410123 6:98947635-98947657 GCGCGGGGGCGCGGGGCCGCGGG + Intronic
1014844450 6:126258293-126258315 GGGCGGGGCAGTGGTGGCTCAGG - Intergenic
1015910053 6:138161388-138161410 GCGGTGGGCTGCGGTGGGGCTGG - Intergenic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1017672009 6:156777812-156777834 GCGCGGCGCGGCGGCGGCGGCGG + Intergenic
1017717508 6:157222898-157222920 GCTCGGAGCTGGGGTGGGGCTGG + Intergenic
1019349931 7:549887-549909 GCGGCGGGGTGCAGTGGCGCGGG + Exonic
1019526839 7:1484277-1484299 GTGAGGGTCTGCGGTGCCGCGGG - Intronic
1019536116 7:1530722-1530744 GCGGGCGGGTGCGGTGGCGGCGG + Exonic
1022094476 7:27130291-27130313 GCGCGAGGCTGCAGGGGCGGCGG + Exonic
1022100250 7:27165148-27165170 GCCCGTGGCGGCGGCGGCGCCGG - Exonic
1022101922 7:27174008-27174030 TCGCCGGGCAGCGGTGGCGGTGG - Exonic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1023177636 7:37448773-37448795 GCGTGGGGCCGCGGCGGCGTGGG + Exonic
1024089107 7:45921062-45921084 CCGCGGGCCGCCGGTGGCGCGGG - Exonic
1025211169 7:57020329-57020351 GAGCGGGGCTGGGGCGGGGCAGG - Intergenic
1025660786 7:63556518-63556540 GAGCGGGGCTGGGGCGGGGCAGG + Intergenic
1026297105 7:69062719-69062741 TCGCGGGGATGGGGGGGCGCTGG - Intergenic
1026471018 7:70694289-70694311 GCGCGGGGCGGCGGCGCCTCTGG - Intronic
1026732744 7:72925551-72925573 GCGGCGGGCTGCGGCGGCCCGGG - Intronic
1026979549 7:74518339-74518361 GCCCGGGGCTGGGCTGGGGCTGG + Intronic
1027001487 7:74657608-74657630 GGGCGGCGCTGCGGATGCGCAGG + Intergenic
1028621582 7:92834003-92834025 GCGCGGGGGAGGGGAGGCGCCGG + Intronic
1029074949 7:97928046-97928068 GCGCGGGGGTCCGGGGGTGCCGG - Intergenic
1029238728 7:99143810-99143832 GGGCTGGGGGGCGGTGGCGCTGG - Exonic
1029570195 7:101363606-101363628 CCGCGGGGCTGCGGGGCTGCGGG + Intronic
1029896402 7:103989364-103989386 GCGCGCGGCGGCGGCGGCGGCGG - Exonic
1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG + Intergenic
1031317294 7:120273423-120273445 GTGCGGGGCTGCGGGGCGGCGGG - Intergenic
1032525707 7:132577099-132577121 GCGCGGGGCTGCGGCGGTGGTGG + Exonic
1033299826 7:140176360-140176382 GGGCGGGGCGGCGGCGGCCCGGG + Intronic
1034418723 7:150978182-150978204 GCGCGGGGACGCGGCGGAGCGGG - Exonic
1034440223 7:151082403-151082425 GCGCTGGGCTGGGATGGCGTTGG + Exonic
1034475124 7:151277147-151277169 GCTCCGGGCTGCAGCGGCGCAGG - Intronic
1034659902 7:152759950-152759972 GAGCGGGGCCGCGGAGGAGCGGG - Intronic
1035021687 7:155804277-155804299 GCGTGGGCCTGCGGAGGGGCGGG + Intronic
1035212118 7:157336589-157336611 CCGCGGTCCTGCGGTGGAGCTGG - Intronic
1036803208 8:11808368-11808390 GGGCGGGGCTGCGGGGCTGCGGG + Intronic
1036900315 8:12665242-12665264 GCGCGGGGGTCCGGGGGTGCCGG - Intergenic
1036910569 8:12754671-12754693 GCGCGGGGATGCGGCGGGGCCGG - Intronic
1037297195 8:17413503-17413525 GCGCGTCGCGGCGGCGGCGCAGG - Intronic
1037765362 8:21769239-21769261 GGGCGGGGCTGGGGCGGGGCTGG - Intronic
1037880452 8:22571106-22571128 GCGCAGGGCTGAGGGGGAGCTGG - Exonic
1037886713 8:22599552-22599574 GAGCGGGGCTGGGGGGGCGGGGG - Intronic
1037901770 8:22692975-22692997 GCGAGCGGCGGCGGTGGCGGCGG - Exonic
1037920409 8:22801752-22801774 GAGCCGGGCTGCTGTGGCTCTGG - Intronic
1038185674 8:25272636-25272658 GAGTGGGGTTGCGGAGGCGCTGG - Intronic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1038575898 8:28702566-28702588 GGGCGGGGGTGGGGTGGTGCGGG - Intronic
1039592007 8:38757243-38757265 GGGCGGGGAGGCGGTGGGGCGGG - Intronic
1040581780 8:48704331-48704353 GCGCGTGGCTTCGGAGGCTCAGG + Intergenic
1040582562 8:48709142-48709164 GCGCGTGGCTTCGGAGGCTCAGG + Intergenic
1040694463 8:49979295-49979317 GCTCTGGGCTGTCGTGGCGCGGG - Intronic
1041059479 8:54022225-54022247 GCCCGGGCCTGCGGTGGTGGGGG - Exonic
1041689850 8:60678527-60678549 GCGCGGAGCTGCTGGGCCGCGGG - Intergenic
1047732381 8:127737718-127737740 GGGAGGGGCTGCGGTGCCGGCGG + Intronic
1048886516 8:138914072-138914094 GCGCGGGGCTGGGGAGGAGCTGG + Intergenic
1049384777 8:142337699-142337721 TGGTGGGGCTGCGGTGTCGCAGG - Intronic
1049419486 8:142510588-142510610 GCTGGGGGCGGCGGGGGCGCGGG + Intronic
1049558232 8:143294314-143294336 GGGCTGGGCGGCGGCGGCGCTGG - Intronic
1049585416 8:143430528-143430550 GCGCGGGGCGGCGGCGCCGAGGG + Intergenic
1049668806 8:143860555-143860577 GCGGGCGGCGGCGGTGGCGGCGG + Exonic
1049669221 8:143862157-143862179 GCGGGCGGCGGCGGTGGCGGCGG + Exonic
1049671103 8:143870268-143870290 GCGCAGGGGTGTGGTGGGGCCGG - Exonic
1051287221 9:15510229-15510251 GCGAGGAGATGCGGCGGCGCGGG + Exonic
1051665644 9:19464972-19464994 GCGCAGGGCTGCGGCGGGGGCGG + Intergenic
1052362214 9:27573444-27573466 GCCCGCGGCGGCGGAGGCGCAGG - Intronic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053293736 9:36898917-36898939 CAGCTGGGCTGCGGTGGCGATGG - Intronic
1056532477 9:87498779-87498801 GCGCGGGGCTGAGGGGTCGGGGG + Intronic
1057488542 9:95505855-95505877 GCGCGGGGCTGCGGAGGCGGCGG - Intronic
1057533566 9:95876045-95876067 GCGCGGGGCTGTGGCGCCGACGG - Exonic
1057547260 9:96027609-96027631 GCGCTGGGCGGCGGCGGCGCCGG - Intergenic
1057832687 9:98419095-98419117 GCCCGGGGGGGCGGTGGAGCAGG + Intronic
1057997115 9:99828625-99828647 GCGGGGGGATGCGGCGGCGAGGG - Exonic
1058467519 9:105244498-105244520 GCGCGGCGCTGAGGAGGCGGCGG + Intergenic
1058885838 9:109320699-109320721 GCGCGCGGCGGCGGCGGCGGCGG - Exonic
1059470931 9:114504710-114504732 GCGGGCGGCGGCGGGGGCGCGGG - Exonic
1059769880 9:117414942-117414964 GGGAGGGGCTGCGGTGCTGCGGG + Exonic
1060109250 9:120894729-120894751 GCGCGAGGCTGGGGAGCCGCGGG - Intronic
1060485125 9:124041604-124041626 GGGTGGGGCTGCGGTGGGGCTGG + Intergenic
1061050493 9:128191894-128191916 GCGCGGGGCTGCGGTGAGAGGGG + Intronic
1061084918 9:128393113-128393135 GCGCGGGGCTGGGCGGGGGCGGG - Intergenic
1061472159 9:130835313-130835335 GCGCGGGGCGGCGGTGAGGGCGG + Intronic
1062006142 9:134239483-134239505 GAGCAGGGGTGCGGTGGCACTGG + Intergenic
1062022520 9:134326234-134326256 TCGCGGGGCGGCGGCGGCGGAGG + Intronic
1062022580 9:134326397-134326419 GCGCGCGGCGGCGGGGGCGCGGG + Intronic
1062022596 9:134326514-134326536 GCCGGCGGCTGCGGTGGCGGCGG - Intronic
1062162469 9:135087829-135087851 GCGCGGGGCGGCGGCGGCGGCGG + Exonic
1062230606 9:135479813-135479835 GCGCGGGGCGGCGGCAGCGGCGG + Exonic
1062377158 9:136267336-136267358 GGGCGGGGCTACGGCGGGGCGGG + Intergenic
1062403011 9:136380628-136380650 CTGAGGGGCTGCGGTGGAGCGGG + Intronic
1062420958 9:136482670-136482692 CGGCTGGGCTGCGGTGACGCCGG - Intronic
1062488152 9:136791331-136791353 GAGCGGGCCTGCGCAGGCGCAGG - Intergenic
1062584188 9:137241595-137241617 GCGCGGGGCGGGGGAGGGGCGGG + Intronic
1062653543 9:137590473-137590495 GCGCGCGGTGGCGGTGGCGGCGG - Exonic
1062657818 9:137613313-137613335 GCCCTGTGCTGCTGTGGCGCTGG + Intronic
1062697634 9:137883633-137883655 GGGCTGGGCTGCTGTGGCTCTGG + Intronic
1187547388 X:20267062-20267084 GCGCGCGGCGGTGGTGGCGGCGG - Intronic
1189337130 X:40176766-40176788 GGGCCGGGCGGGGGTGGCGCGGG - Intronic
1189717618 X:43882165-43882187 GCGGGGGGCGGCCGTGGGGCAGG - Intronic
1190245706 X:48688923-48688945 GAGCTGGGCGGCGGTGGCGGTGG - Exonic
1192630953 X:72777481-72777503 GCGGGGGGCGGCGGGGGCGCGGG - Intronic
1192650756 X:72943320-72943342 GCGGGGGGCGGCGGGGGCGCGGG + Intronic
1196840297 X:119853146-119853168 GCGAGGGGATTGGGTGGCGCAGG - Intergenic
1198807301 X:140504749-140504771 TCCCGGGGCTGCGGGGCCGCCGG + Exonic
1199771141 X:150976081-150976103 GAGCAGGGACGCGGTGGCGCTGG + Intergenic
1200003194 X:153072527-153072549 GCGCGCCGCTGCGGCGGCGGCGG - Exonic
1200004529 X:153077482-153077504 GCGCGCCGCTGCGGCGGCGGCGG + Intergenic
1200068843 X:153518007-153518029 GCGCGGGGCTCAGGTGCCTCGGG - Intronic
1200117672 X:153776485-153776507 GGGCGGGGCTGGGGCGGGGCAGG + Intronic
1200117725 X:153776599-153776621 GGGCGGGGCTGGGGTGGGGAGGG + Intronic
1200144968 X:153921693-153921715 GCGCCGCGCTGAGGTGGAGCTGG - Exonic
1200240502 X:154490670-154490692 GGGAGGGGCTTCGGTGGGGCGGG - Exonic
1201867837 Y:18673570-18673592 GCGCGGGGGTGGGGGGGGGCAGG - Intergenic