ID: 971457920

View in Genome Browser
Species Human (GRCh38)
Location 4:26861271-26861293
Sequence TGCCCCGGCACCTCCGCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971457916_971457920 4 Left 971457916 4:26861244-26861266 CCGGAGCGGCGGACGGATGCGAG 0: 1
1: 0
2: 0
3: 2
4: 29
Right 971457920 4:26861271-26861293 TGCCCCGGCACCTCCGCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971457920 Original CRISPR TGCCCCGGCACCTCCGCGGG CGG Exonic
900098082 1:948457-948479 TGCCCAGGCCCCTCCCCAGGAGG + Intronic
900556603 1:3283890-3283912 AGCCCAGGTGCCTCCGCGGGAGG + Intronic
900959491 1:5909990-5910012 AGCCCCTGCACCTCAGCAGGAGG + Intronic
903181240 1:21606021-21606043 GGCCCCGGCCCCTCCCTGGGGGG - Intronic
903331900 1:22600821-22600843 AGCCCTGGCAGGTCCGCGGGCGG + Intronic
904045165 1:27604227-27604249 CGCCCCGGCCGCTCCGCGCGCGG + Intronic
917853001 1:179081549-179081571 TGCCCTGGCTCCTCCGCAGAGGG - Exonic
920491030 1:206415493-206415515 TGCCCTGGCCCCTCGGTGGGAGG - Intronic
924436727 1:244049041-244049063 CGCCCCGGCACCCCGGCGGGCGG + Intronic
1062767488 10:76542-76564 AGCCCCGGCCCCTCCGGGGTGGG + Intergenic
1075438387 10:122461405-122461427 CGCCCTGCCCCCTCCGCGGGCGG + Intergenic
1077043887 11:535944-535966 AGCCCCGGGACCTCCGCGGTGGG - Intronic
1077196730 11:1284731-1284753 AGCCCTGGCACCTGCGCGGGCGG + Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1083039087 11:59668956-59668978 CTCCCCGGCTCCTCCGCGCGCGG + Exonic
1084045114 11:66563848-66563870 TGTCCAGGCCCCTCCCCGGGAGG - Exonic
1085195946 11:74671792-74671814 TGCCCTGGCACCTCTCCAGGAGG - Intergenic
1089120662 11:116132423-116132445 GGCCCAGTCACCTCAGCGGGAGG + Intergenic
1092046139 12:5432864-5432886 TGCCGCGGCACCTCCCCGCCCGG - Intronic
1094497533 12:30997865-30997887 TGCCTGGGGACCTCCCCGGGTGG - Intergenic
1100166627 12:91924167-91924189 TGCCCCGGCCGCTCCGAGTGCGG + Intergenic
1102464230 12:113119175-113119197 TGCCCCGTCCCCACTGCGGGTGG - Exonic
1105378046 13:19863160-19863182 TGCCCCGCGACCTCCCCGGGCGG + Intronic
1105389218 13:19959214-19959236 TGCCCCGCGACCTCCCCGGGCGG - Intronic
1107779245 13:43880058-43880080 TGCCCGGGCACCTCCACCGGCGG - Intronic
1112290793 13:98143046-98143068 TGGGCCGGCCCCTCGGCGGGGGG - Intronic
1113371923 13:109732756-109732778 TGCCCCCGCACCCCCGCCGTGGG - Intergenic
1117092797 14:52267721-52267743 GCCCCCGGCAGCTCCGCGCGCGG - Exonic
1122574541 14:102733361-102733383 GGCCGCGGCACCCCCTCGGGTGG - Intergenic
1122786363 14:104166051-104166073 TGCCCCAGCACCGCCAGGGGTGG - Intronic
1202849719 14_GL000225v1_random:9110-9132 TGCCCCGGCTCCTCCGGAAGGGG + Intergenic
1125155401 15:36579646-36579668 TCCACCGGCACCTCCGCGGCGGG - Exonic
1125957517 15:43800535-43800557 AGCCCCGCCTCCTCCCCGGGCGG + Exonic
1127853438 15:62935307-62935329 TGCTCAGGCACCTCCAGGGGTGG - Intergenic
1129199874 15:73992333-73992355 TGCGCCCGCGCCGCCGCGGGTGG - Exonic
1132326418 15:100973792-100973814 GTCCCCGGCACCTGCGCGGGAGG - Exonic
1136927501 16:34388559-34388581 GCCCCCGCCACCTCCGCCGGTGG - Intergenic
1136977073 16:35023247-35023269 GCCCCCGCCACCTCCGCCGGTGG + Exonic
1137056754 16:35749767-35749789 TGACCCGGGACCTCCCCGTGTGG + Intergenic
1137454783 16:48609984-48610006 GCCCCCGGCGCCGCCGCGGGAGG - Exonic
1140046187 16:71441850-71441872 GGCGCCAGCACCTCCGCGGGCGG + Intergenic
1142350635 16:89577727-89577749 TGCCCCGTCCCCTCGGAGGGAGG + Intronic
1142393158 16:89816089-89816111 AGCCCCGGCCCCTCTTCGGGAGG - Intronic
1146034033 17:29390642-29390664 CGCCGCGGCCCCTCGGCGGGCGG - Exonic
1147994465 17:44353498-44353520 CTCCCCGGCACCTCCCCGTGGGG + Exonic
1148556627 17:48582324-48582346 TTGCCCGGCGCGTCCGCGGGCGG - Intronic
1149365174 17:55936603-55936625 TGCCCCGGCACCTCGTCCAGTGG - Intergenic
1150643688 17:66965490-66965512 CGCGCCGGCACCCCCGGGGGAGG + Intronic
1152147158 17:78575264-78575286 TGCCCCGGCCCCGCCATGGGGGG + Intronic
1152231444 17:79115862-79115884 TTCCCCGGCCCCTCCAAGGGGGG + Intronic
1152923924 17:83079233-83079255 GGCCCCGGCACCGCCTCGCGGGG + Intergenic
1152960323 18:75888-75910 AGCCCCGGCCCCTCCGGGGTGGG + Intergenic
1154160901 18:11980767-11980789 CTCCCCGGCACCTCCGGGGCTGG + Intergenic
1158509577 18:58078755-58078777 TGCTCTGGCCCCTCCGAGGGAGG + Intronic
1160673139 19:375756-375778 TCCCCGGCCACCTCCTCGGGGGG + Exonic
1160691455 19:462138-462160 AGCCCCTGCGCGTCCGCGGGAGG + Intergenic
1161048901 19:2151636-2151658 CGCCCCGCCACCTCCCCGGCAGG + Intronic
1161206046 19:3041978-3042000 TTCCCCCGCAGCACCGCGGGAGG - Intronic
1161467919 19:4442478-4442500 TGCCCTGCCACATCCTCGGGCGG + Intronic
1161681296 19:5681088-5681110 AGGCCCGGCCCCTCCCCGGGAGG + Exonic
1165313353 19:35041239-35041261 TGCCCCGGCCCCTCCCCCGCTGG - Intronic
929589274 2:43134624-43134646 TGCCCCCCCACCCCCGAGGGAGG + Intergenic
934761242 2:96858204-96858226 TGCCCCGAGGCCTCCGCGCGAGG + Intergenic
936399828 2:112156626-112156648 TGCCCCAGGACCTGCGTGGGAGG + Intronic
939969808 2:148645674-148645696 TCCCGCTGCACCTTCGCGGGCGG - Intronic
941902979 2:170695327-170695349 TGCCCAGGCAGCTCCGTGGGTGG - Intergenic
944632760 2:201643420-201643442 TGCCCCGGCGCAACCGCCGGCGG + Exonic
947155985 2:227163948-227163970 GGCCCCGGCACCTGCCTGGGAGG - Intronic
948847015 2:240687994-240688016 TGGCCCTGCCCCTCCTCGGGTGG - Intergenic
1170995036 20:21346650-21346672 TGCCCTGTCACCTGGGCGGGAGG + Intronic
1171196753 20:23205970-23205992 TGTCCCAGCACCTCCCGGGGTGG + Intergenic
1172011494 20:31848555-31848577 TGCACCTGCACCTGCGGGGGCGG + Intronic
1173174615 20:40754911-40754933 TGCACCTGCACCTCCACTGGGGG - Intergenic
1173190409 20:40871488-40871510 TGCCCAGGAACCACCGCTGGAGG + Intergenic
1175366815 20:58461447-58461469 TGCCCCTGCACCTGGGCGGCTGG - Exonic
1175755361 20:61526165-61526187 TGCCCCTCCCCCTCCCCGGGTGG + Intronic
1176027673 20:62994084-62994106 TGCCTCAGAACCTCAGCGGGAGG - Intergenic
1176194354 20:63830711-63830733 CTCCCCGGCACCTCCGAGAGGGG - Intronic
1181006727 22:20016996-20017018 GGCCGCGGCCCCTCCGCGAGGGG - Intronic
1181872159 22:25908311-25908333 TGCCCCCGCAGCTCCGCCAGCGG + Exonic
1185042823 22:48514141-48514163 TGCAGCGGCAACTCCGCGGCCGG - Intronic
954677771 3:52325205-52325227 TGCCCAGGCACCACCTCTGGTGG + Intronic
955161543 3:56468658-56468680 GGCCCGGGCGCCTCCGCTGGGGG + Intergenic
969543807 4:7810939-7810961 TGCCCCTGCAATTCCGCCGGAGG - Intronic
969716063 4:8868738-8868760 TGTCCCGGGACTTCTGCGGGAGG - Intronic
971457920 4:26861271-26861293 TGCCCCGGCACCTCCGCGGGCGG + Exonic
984778546 4:183504741-183504763 TGCCCCCGCCCCTCCGCCCGCGG - Intergenic
986225478 5:5807838-5807860 GGCACCAGCACCTCCACGGGAGG + Intergenic
989372319 5:40722760-40722782 TGCCCCGCCACCTCCGGGACGGG - Intronic
993457287 5:88141406-88141428 TTCCCCGGCAGCTGCTCGGGCGG + Intergenic
1002541159 5:179907515-179907537 CGCCCCGGCCCCTCCGCGCCCGG + Intronic
1003566906 6:7229843-7229865 TGGCCCGGCAGCTCCGCCCGCGG - Exonic
1006396155 6:33788861-33788883 CGCCGCGGCCTCTCCGCGGGCGG - Exonic
1007394572 6:41570256-41570278 TGCCATGGCTCCTCCACGGGAGG - Intronic
1017324703 6:153131422-153131444 GGCCCCGCCCCCTCCCCGGGCGG + Intergenic
1019331704 7:463606-463628 GGCCCCGGCCCCACTGCGGGCGG + Intergenic
1019449659 7:1090654-1090676 AGCCCGGGCACCGCCGTGGGCGG + Intronic
1029813909 7:103074972-103074994 GGCCCCGGCGTCTCCGCGTGGGG + Exonic
1035059210 7:156056713-156056735 AGCCCCGGCACCACCGAGGAAGG - Intergenic
1036785253 8:11681276-11681298 TTCCCCGGAACCTCAGCGTGCGG - Intronic
1039608490 8:38901423-38901445 AGCCCCGGCCCCTGCACGGGGGG + Exonic
1049536772 8:143186172-143186194 TGCGCCCGCACCTCCCCGCGCGG + Intergenic
1049603017 8:143516701-143516723 GGCCCCAGCACCTCCCCAGGTGG + Intronic
1049746465 8:144265270-144265292 AGCTCCGGCGCCTCCGAGGGCGG - Intronic
1060397224 9:123324812-123324834 AGCCAGGGCACCTCCCCGGGCGG - Intergenic
1060479959 9:124012142-124012164 TGCCCCTGCGCCTCGGCGGGAGG + Exonic
1060930602 9:127487358-127487380 TGCCCAGCCACCTCCATGGGTGG - Intronic
1062234138 9:135500077-135500099 TGGCCCGGTCCCCCCGCGGGTGG - Intronic
1062738175 9:138150194-138150216 AGCCCCGGCCCCTCCGGGGTGGG - Intergenic
1192167431 X:68834679-68834701 TGCACCTGCACCTCCCAGGGTGG - Intronic
1192208325 X:69110484-69110506 GGCCCCTGCCCCTCCGTGGGTGG - Intergenic