ID: 971458800

View in Genome Browser
Species Human (GRCh38)
Location 4:26871977-26871999
Sequence TGCATCCCATTTTAGAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1052
Summary {0: 1, 1: 0, 2: 8, 3: 111, 4: 932}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971458800_971458803 27 Left 971458800 4:26871977-26871999 CCTTATCTCTAAAATGGGATGCA 0: 1
1: 0
2: 8
3: 111
4: 932
Right 971458803 4:26872027-26872049 CTTAGAATAGAGCCTGGCAAGGG 0: 1
1: 0
2: 8
3: 36
4: 297
971458800_971458801 21 Left 971458800 4:26871977-26871999 CCTTATCTCTAAAATGGGATGCA 0: 1
1: 0
2: 8
3: 111
4: 932
Right 971458801 4:26872021-26872043 TGTGTGCTTAGAATAGAGCCTGG 0: 1
1: 0
2: 7
3: 62
4: 459
971458800_971458802 26 Left 971458800 4:26871977-26871999 CCTTATCTCTAAAATGGGATGCA 0: 1
1: 0
2: 8
3: 111
4: 932
Right 971458802 4:26872026-26872048 GCTTAGAATAGAGCCTGGCAAGG 0: 1
1: 2
2: 6
3: 59
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971458800 Original CRISPR TGCATCCCATTTTAGAGATA AGG (reversed) Intronic
900961118 1:5921007-5921029 TCCATCCCATTTTACAGCTGAGG + Intronic
901115155 1:6837518-6837540 TGCTTCCCATTTCTGAGAAAGGG + Intronic
901174567 1:7289484-7289506 GGCATCTCATTTTATAGATGAGG - Intronic
901736223 1:11313828-11313850 TGCCTCCCATTTTATAGATGGGG + Intergenic
901736799 1:11317766-11317788 TTATTCCCATTTTACAGATAAGG + Intergenic
901885154 1:12217552-12217574 TTAATCCCATCTTACAGATAAGG - Intergenic
901894412 1:12298168-12298190 TTATTCCCATTTTATAGATAAGG + Intronic
902106969 1:14045732-14045754 TTAATCCCATTTTACAGATGAGG - Intergenic
902169207 1:14597511-14597533 TTATTCCCATTTTAGGGATAAGG - Intergenic
902535396 1:17116731-17116753 ATCATCCCATTTTACAGATGAGG - Intronic
902566428 1:17314607-17314629 TGATTCCCATTTTACAGAGAAGG + Intronic
903032571 1:20474508-20474530 ATCAGCCCATTTTAGAGAGAAGG + Intergenic
903041218 1:20532218-20532240 AGCCTCTCTTTTTAGAGATAGGG - Intergenic
903129069 1:21266551-21266573 ACCATCCCATTTCAGAGACAAGG + Intronic
903279891 1:22244435-22244457 TGATTCCCATTTGACAGATAAGG - Intergenic
903287537 1:22286150-22286172 TGCCTCCCATTTAACAGATGGGG + Intergenic
903301978 1:22385716-22385738 TGAGTCCCATTTTACAGATGGGG + Intergenic
903326780 1:22573388-22573410 TGAGTCCCATTTTACAGATGTGG + Intronic
903374038 1:22854618-22854640 TTATTCCCATTTTAGAGATGAGG - Intronic
903374395 1:22856692-22856714 TCATTCCCATTTTACAGATAAGG - Intronic
903377140 1:22873979-22874001 CACATCCCATTTTACAGGTAAGG + Intronic
903380673 1:22894999-22895021 TTCTCCCCATTTTACAGATAAGG + Intronic
903455711 1:23484922-23484944 GGCTTCCCATTGTACAGATAAGG - Intergenic
903620589 1:24695391-24695413 TGATCCCCATTTTACAGATAAGG - Intergenic
903679345 1:25086922-25086944 TGCATCCCATTTCTCAGATGAGG - Intergenic
903765243 1:25729811-25729833 GGCATCCCATTTTCTAGATGAGG + Intronic
903790694 1:25890982-25891004 TTTATCCCATTTTATAGATGAGG - Intronic
903809785 1:26028877-26028899 TGCCTCCCATTTTACAGATGAGG + Intronic
904133519 1:28293024-28293046 TTCTCCCCATTTTAGAGATGGGG - Intergenic
904161508 1:28525459-28525481 TGCATCCCCTTTTATAGATGAGG + Intronic
904446116 1:30574135-30574157 TTTATCCCATTTTGCAGATAAGG - Intergenic
904513168 1:31031435-31031457 TTATTCCCATTTTAGAGATTAGG + Intronic
904530180 1:31163445-31163467 AGCATCCTATTTTATAGATGAGG - Intergenic
904774571 1:32898907-32898929 TTCTTCCCATTTTACAGATGGGG - Intronic
905075398 1:35266462-35266484 GGTGTCCCATTTTACAGATAAGG + Intergenic
905104093 1:35552518-35552540 TTCTTCTCATTTTATAGATAAGG - Intronic
905245414 1:36609929-36609951 TTCATCCCATTTTAGAGATGGGG + Intergenic
905269247 1:36776232-36776254 TTATTCCCATTTTACAGATAAGG + Intergenic
905345631 1:37309293-37309315 TTCTCCCCATTTTAGAGATGGGG + Intergenic
905364140 1:37439563-37439585 TAGAGCCCATTTTACAGATAAGG - Intergenic
905646602 1:39628984-39629006 TTATTCCCATTTTAGAGATGAGG + Intronic
905919307 1:41708968-41708990 TTACTCCCATTTTAGAGTTAAGG + Intronic
905937005 1:41832754-41832776 TGATTCACATTTTACAGATAAGG + Intronic
906815988 1:48879724-48879746 TTAACTCCATTTTAGAGATAAGG + Intronic
907249577 1:53129300-53129322 TTCTTCCCACTTTATAGATAAGG + Intronic
907251144 1:53140745-53140767 CACATCCCATTTTACAGACAAGG + Intronic
907355385 1:53868402-53868424 TTCTTCCCATTTTATAGATGAGG - Intronic
907410768 1:54281795-54281817 GCCCTCCCATTTTAGAGATGAGG - Intronic
907518593 1:55008701-55008723 ATCATCCCATTTTGCAGATAGGG - Exonic
907562176 1:55401097-55401119 TTCTTCCCATTTTACAGATGAGG + Intergenic
907570148 1:55475984-55476006 GGGTTCCCATTTTAGAGATGAGG + Intergenic
907779063 1:57548270-57548292 ATCATCCCATTTTATAGATGAGG + Intronic
907921901 1:58921896-58921918 TGTCTCCCATTTTACAGATGAGG + Intergenic
907972833 1:59401554-59401576 ACAACCCCATTTTAGAGATACGG + Intronic
908792312 1:67794997-67795019 CGATACCCATTTTAGAGATAAGG + Intronic
908827766 1:68149936-68149958 TACATCCCATTTTATAGATGAGG + Intronic
909415567 1:75402308-75402330 TCCATCCCATTTTACAGAGAAGG - Intronic
909491913 1:76235635-76235657 TGATTCCCAATTTAAAGATAGGG - Intronic
910039782 1:82835796-82835818 TTATTCCCATTTTATAGATAAGG + Intergenic
910061618 1:83100372-83100394 TTATTCCCATTTTACAGATAAGG + Intergenic
910073575 1:83248637-83248659 TGCATCTAATTTTGTAGATAAGG + Intergenic
910118994 1:83763324-83763346 TGACCCCCATTTTACAGATAAGG + Intergenic
910185130 1:84530679-84530701 ATTATGCCATTTTAGAGATAAGG + Intergenic
910659467 1:89655831-89655853 TGCATCCCATCTCAGAGGTGGGG + Intronic
910696965 1:90029349-90029371 TGCATCTAATTTTAGGGATTTGG + Intronic
910966182 1:92810246-92810268 TTAATCCCATTGTACAGATAGGG + Intergenic
911353902 1:96792339-96792361 TCGATCCCATTTTATAGATTTGG + Intronic
911586483 1:99696889-99696911 TGTACCTCATTTTATAGATAAGG - Intergenic
912440030 1:109690763-109690785 TCTCGCCCATTTTAGAGATAAGG + Intronic
912455039 1:109791625-109791647 TTCACCCCATTTTACAGATGAGG + Intergenic
912890743 1:113526974-113526996 TTCTTCCCATTTTACAGATGGGG - Intronic
913006934 1:114642662-114642684 TTAATCTCATTTTACAGATAAGG + Intronic
913286067 1:117228024-117228046 TTATTCCCATTTTAGAGATGAGG + Intergenic
913461454 1:119090368-119090390 TTCCTCCCATTTTACAGCTAAGG - Intronic
914247184 1:145895100-145895122 ATCTTCCCATTTTAGAGATTAGG + Intronic
914347313 1:146810968-146810990 ATCACCTCATTTTAGAGATAAGG + Intergenic
914425712 1:147573668-147573690 TGCTCCCCATTTTAGAGATAAGG - Intronic
914446147 1:147752211-147752233 TTGACCCCATTTTACAGATAAGG - Intergenic
914721358 1:150291859-150291881 TTAGTCCCATTTTAGAGATGAGG + Intergenic
914878804 1:151532143-151532165 TTAATCCCATTTTACAGATGGGG + Intronic
915072408 1:153281518-153281540 TACATCCCATTTTGCAGATCTGG + Intergenic
915108383 1:153548153-153548175 GTCATCCCATTTTACAGATGAGG + Intronic
915539047 1:156556282-156556304 GGCATTCTATTTTAGAGATGGGG - Intronic
915614989 1:157030765-157030787 TCATTCCCATTTTATAGATAGGG - Intronic
915725034 1:158011387-158011409 TTCAGCCCATTTTACAGATGAGG - Intronic
916175873 1:162037905-162037927 TAGATGCCATTTTACAGATAGGG + Intergenic
916233706 1:162564304-162564326 TTAATCTCATTTTACAGATAAGG + Intronic
916416209 1:164594124-164594146 TTATCCCCATTTTAGAGATAAGG + Intronic
916502439 1:165398492-165398514 AGAATCCCATTTTACAGATTCGG + Intergenic
916673980 1:167050803-167050825 TTCTTCCCATTTTACAGATGAGG - Intergenic
916744356 1:167672991-167673013 TTGATCCCATTTTACAGATGAGG + Intronic
916805015 1:168250733-168250755 TGCATCCCCTTTTGCAGAAAGGG + Exonic
916873787 1:168946654-168946676 TTAATCCCATTTTACAGATGAGG + Intergenic
916933343 1:169602519-169602541 ATCATCTCATTTTATAGATAAGG - Intronic
916938314 1:169654406-169654428 TGGATCCCATTTCTGAGGTATGG - Intergenic
917468619 1:175306969-175306991 TTTATACCATTTTACAGATAAGG + Intergenic
917533366 1:175856440-175856462 GGAATCCCATTTTATAGCTAAGG - Intergenic
917836793 1:178947455-178947477 TTTCTCCCTTTTTAGAGATAGGG - Intergenic
917916524 1:179707931-179707953 TTACTCCCATTTTACAGATAAGG + Intergenic
918573569 1:186027542-186027564 TCCTTCCCATTTTACAGATGAGG - Intronic
918645391 1:186898096-186898118 TTCCTCTCATTTTACAGATATGG + Intronic
918698299 1:187574001-187574023 TGCATCCACTTCTAGAGAAAGGG + Intergenic
919252115 1:195069058-195069080 TGGATAACATTTTAGAGCTAAGG + Intergenic
919346055 1:196379826-196379848 TAATTCACATTTTAGAGATAAGG - Intronic
920046603 1:203136778-203136800 TGCTTCCCCTTTGAGAGAGAAGG + Intronic
920214677 1:204353699-204353721 TTATTCCCATTTTAGAGATGAGG + Intronic
920574549 1:207049934-207049956 TGCATCCCAATTTAGTGAAGGGG + Intronic
920672672 1:208016368-208016390 TCACTCCCATTTTAGAGATGGGG - Intergenic
920710498 1:208289966-208289988 TCATTCCCATTTTACAGATAAGG - Intergenic
920836750 1:209518146-209518168 TCCATCCCATTTTATAAATGAGG - Intergenic
921194641 1:212743599-212743621 TGCATGCTATTTTTAAGATAGGG - Intronic
921949717 1:220916799-220916821 TTGATTCCATTTTATAGATAAGG + Intergenic
922341317 1:224657439-224657461 TGCCTCACATTTTATTGATAAGG + Intronic
922468479 1:225861216-225861238 CGATTCCCATTTTACAGATAAGG + Intronic
922504612 1:226119256-226119278 TTGGTCCCATTTTATAGATAAGG + Intergenic
922778142 1:228226965-228226987 TGAATCCCATGTTACAGATGAGG - Intronic
922915706 1:229255799-229255821 ATGATTCCATTTTAGAGATAAGG - Intergenic
923437908 1:233985446-233985468 TGTTTCCAAATTTAGAGATATGG + Intronic
923686722 1:236158736-236158758 TGCACCCCCTTTTAAGGATAGGG + Intronic
923742757 1:236670881-236670903 GGCCTCTCATTTTAAAGATAAGG - Intergenic
923760345 1:236836907-236836929 ATGATCCCATTTTAGAGATGAGG - Intronic
923764657 1:236881871-236881893 TGGTCCCCATTTTAGAGATCAGG + Intronic
924021263 1:239786427-239786449 TGATTCCCATCTTATAGATAAGG + Intronic
924025594 1:239829781-239829803 TTATTCCCATTTTAGAGATAGGG - Intronic
1063737845 10:8781005-8781027 TCCATCCCACCTTAGAAATATGG - Intergenic
1063743102 10:8846935-8846957 TGCAAATCATTTTAAAGATAAGG - Intergenic
1063965107 10:11340500-11340522 TGGATCCCATTTTGTAGATGGGG - Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1064649726 10:17496650-17496672 TTCATTCTATTTTTGAGATAGGG - Intergenic
1064741094 10:18435503-18435525 TGCATACCTTTTTTGATATAGGG + Intronic
1065904420 10:30237312-30237334 TCTTTCTCATTTTAGAGATAAGG + Intergenic
1066024603 10:31342227-31342249 TTATTCCCATTTTACAGATATGG + Intronic
1066363956 10:34758326-34758348 TGCTCCCCATTTTACAGATAAGG + Intronic
1067285839 10:44907118-44907140 TTCTTCCCATTTTACAGATGAGG - Intergenic
1067933846 10:50591196-50591218 TGGATCCCATTTTCCAGAGAAGG + Intronic
1068214213 10:53962623-53962645 TGTTACCCATTTTAGAGCTAAGG + Intronic
1068912791 10:62396392-62396414 TCATTCCAATTTTAGAGATACGG - Intronic
1069477627 10:68748848-68748870 TGCACCTTTTTTTAGAGATAGGG + Intronic
1069555836 10:69397617-69397639 TTATTCCCATTTTAAAGATAAGG - Intronic
1069834260 10:71298893-71298915 TTGTTCCCATTTTAGAGACAAGG + Intronic
1069859209 10:71460046-71460068 TGGAGCCCATTTTACAGACAAGG + Intronic
1069888270 10:71637486-71637508 TTCTTCCCATTTTACAGATGAGG + Intronic
1070123340 10:73599798-73599820 ACTATCCCATTTTACAGATAAGG + Intronic
1070261950 10:74865070-74865092 TCCTTCCCATTTTACAGATAAGG - Intronic
1070368861 10:75762655-75762677 TTAACCCCATTTTACAGATAAGG - Intronic
1070388164 10:75945851-75945873 AGCTTGCCATTTTAGAGATGGGG + Intronic
1070391300 10:75973172-75973194 TTCATCCCATTTTAGTGATGAGG + Intronic
1070711400 10:78685748-78685770 TTAACCCCATTTTATAGATATGG + Intergenic
1070715267 10:78715913-78715935 AGCTTCCCATTTTACAGATCAGG - Intergenic
1070722632 10:78767366-78767388 TTCAACCCATTTCATAGATATGG + Intergenic
1071304701 10:84288457-84288479 TGCCTCCAATTTTAAATATACGG - Intergenic
1071729233 10:88231513-88231535 AGCAACCCATTTTACAGATGAGG - Intergenic
1072023018 10:91423301-91423323 TACACCCCATTTTATAGATGGGG - Intronic
1072027960 10:91482658-91482680 TCATTCCCATTTTACAGATAAGG + Intronic
1072038530 10:91586256-91586278 TTCTTCCCATTTTATAGATTAGG - Intergenic
1072131641 10:92499602-92499624 TGCATACTTTTTTAGAGATGGGG + Intronic
1072310825 10:94152620-94152642 AGCATTCCATTTTATAGATGAGG - Intronic
1072383824 10:94902974-94902996 TTATTCCCACTTTAGAGATAAGG - Intergenic
1072621789 10:97084482-97084504 TTTCTCCCATTTTACAGATATGG - Intronic
1072793582 10:98337274-98337296 TGTATCCCATTTTACAGATGAGG + Intergenic
1073040155 10:100598553-100598575 ATCATCCTATTTTATAGATAAGG + Intergenic
1073163017 10:101417689-101417711 TTTATTTCATTTTAGAGATAGGG + Intronic
1073204005 10:101759046-101759068 TGAATCCCATTTTACACATGAGG + Intergenic
1073591862 10:104765429-104765451 TACCTCCCATTTTACAGATAAGG - Intronic
1074026719 10:109643273-109643295 TGTTCCCCATTTTAGAGATGAGG - Intergenic
1074421450 10:113312604-113312626 TGAATCCCATTTTGGAGATGAGG - Intergenic
1074512484 10:114128593-114128615 TAATTCCCATTTTACAGATAAGG - Intronic
1074611444 10:115025860-115025882 AACAACCCATTTTACAGATAGGG + Intergenic
1074854195 10:117461449-117461471 TCCTTCCCATTTTATAGCTAAGG + Intergenic
1075088690 10:119430860-119430882 TTATTCCCATTTTAGAGATGAGG + Intronic
1075285887 10:121185549-121185571 TGTCTCCCATTTTACAGAGAAGG + Intergenic
1075356001 10:121776494-121776516 TGAATTCTATTTTAGTGATACGG - Intronic
1075549978 10:123385131-123385153 TGCATTTCATTTGAGAGCTAAGG - Intergenic
1075550611 10:123390161-123390183 TGATTCCCATTTTACAGATGAGG - Intergenic
1075614886 10:123883667-123883689 TGCACACCATTTTATAGATGGGG + Intronic
1075639708 10:124056068-124056090 TGCAGCCCATTATAGAAAGATGG + Intronic
1075859637 10:125663159-125663181 TTATTCCCATTTTACAGATAGGG - Intronic
1075906084 10:126083234-126083256 TGACTCCTATTTTAGAGATGAGG + Intronic
1077723052 11:4646515-4646537 TTAATCCCATTTGACAGATAAGG - Intronic
1078483352 11:11699726-11699748 ATTATCCCATTTTACAGATAAGG + Intergenic
1078534576 11:12162797-12162819 TTCAGGCCATTTTAGAGATGGGG + Intronic
1078547375 11:12256147-12256169 AGCAGCCCAGTTTAGAGAAAGGG - Intronic
1078727317 11:13943171-13943193 TTCATCCCATTCCTGAGATAAGG - Intergenic
1078942587 11:16024403-16024425 AGCAGCATATTTTAGAGATAAGG + Intronic
1078985978 11:16598203-16598225 TTATTCCCATTTTATAGATAAGG + Intronic
1079278679 11:19067790-19067812 GGCATCCCATTTTACAGATGGGG - Intergenic
1079338732 11:19594618-19594640 TCACTCCCATTTTACAGATATGG - Intronic
1079960407 11:26916718-26916740 AGCAACTCATTTCAGAGATAGGG - Intergenic
1080400639 11:31932097-31932119 ACCATCCCATTTTGCAGATAAGG - Intronic
1080668336 11:34355441-34355463 TGATGCCCATTTTACAGATAAGG - Intronic
1080696474 11:34606960-34606982 TGATTCCCATTTTACAGATGAGG - Intergenic
1080711738 11:34754696-34754718 TGAGTCCCATTTTATAGATAAGG - Intergenic
1081249154 11:40808047-40808069 TTCTTCCCATTTTACAAATAAGG - Intronic
1081296325 11:41394153-41394175 TGAACTCCATTTTACAGATAAGG - Intronic
1081645488 11:44787262-44787284 GGATTCCCATTTTACAGATAAGG + Intronic
1081708419 11:45200462-45200484 TTTATCCAATTTTATAGATAAGG + Intronic
1081928033 11:46846756-46846778 GTTATCCCATTTTACAGATAAGG - Intergenic
1082189379 11:49224323-49224345 GTCATCCCAATTTACAGATAAGG + Intergenic
1082287372 11:50332335-50332357 TTCCTCCCATTTTAAAGATGGGG - Intergenic
1082809437 11:57470212-57470234 TGATTGCCATTTTAGAGATGAGG - Intronic
1083125942 11:60565582-60565604 TGCTTCCCATTTCATGGATAAGG - Intergenic
1083328528 11:61885966-61885988 AGTATCCCATTTTACAGATGAGG + Intronic
1083478987 11:62931477-62931499 TGATTCCCATTTTACAGATGAGG - Intergenic
1083613931 11:64017377-64017399 TGGTTCCCATTTTACAGAGAAGG + Intronic
1083620911 11:64048955-64048977 GTCATCCCATTTTAGAGCCAAGG + Intronic
1084118351 11:67054850-67054872 TTCCTCCCATTTTACAGATTTGG - Intergenic
1084184284 11:67463467-67463489 TCCGTCCCATTTTACAGATAAGG - Exonic
1084521943 11:69668614-69668636 TGCCCCCCATTTTACAGATGAGG - Intronic
1084656754 11:70524136-70524158 GGGATCCCATTTTACAGATGAGG + Intronic
1085073053 11:73565527-73565549 TGTTTCCCATTTTACAGATGAGG - Intronic
1085083949 11:73654513-73654535 TTAGTCCCATTTTACAGATAAGG + Intronic
1085187875 11:74591695-74591717 TTATTCCCATTTTATAGATAAGG + Intronic
1085345856 11:75767949-75767971 TTATTCCCATTTTACAGATATGG + Intronic
1085735357 11:79034055-79034077 TTACTCCCATTTTACAGATAAGG - Intronic
1086124486 11:83336254-83336276 TGTATCCCACTTTAAAGATGAGG - Intergenic
1086146062 11:83553197-83553219 TTAATCCCATTTTACAGATGGGG - Intronic
1086238903 11:84665295-84665317 TTAATCCCATTTTACAGATGAGG + Intronic
1086317317 11:85608421-85608443 TGCATTCCATCTTACAGAAAAGG - Intronic
1086677145 11:89622173-89622195 GTCATCCCAATTTACAGATAAGG - Intergenic
1087059771 11:93966087-93966109 TGCATCCTTTTTTTGAGACAGGG - Intergenic
1087155503 11:94897715-94897737 TTCATCTCATTTTACAGATAAGG - Intergenic
1088753695 11:112867292-112867314 ATCATCCCATTTTATAGAAAAGG - Intergenic
1088760321 11:112923077-112923099 TGCTTCACATTTTTCAGATACGG - Intergenic
1088774417 11:113068567-113068589 TTCATCCAGTTTTACAGATAAGG + Intronic
1089007374 11:115103597-115103619 GGACTCCCATTTTAAAGATAAGG + Intergenic
1089009886 11:115123633-115123655 CTGATCCCATTTTAGAGATAGGG + Intergenic
1089306994 11:117532786-117532808 TGTATCCTATTGTACAGATAAGG - Intronic
1089827759 11:121293963-121293985 TGCTCCCCACTTTATAGATAGGG - Intronic
1089896374 11:121934358-121934380 TCTATCCCATTTTACAAATAAGG + Intergenic
1090023486 11:123148073-123148095 AGCATCCTATTTTATAGATGGGG - Intronic
1090494169 11:127193596-127193618 TGATTCCCATTTCAGAGATGAGG + Intergenic
1091023385 11:132121114-132121136 TCATTCCCATTTTAGAGATGGGG + Intronic
1091547771 12:1514803-1514825 AGCATCCCATATTACAGACAAGG - Intergenic
1091829569 12:3540115-3540137 TTATTCCCATTTTAGAGAAAAGG + Intronic
1092013474 12:5136851-5136873 TTATCCCCATTTTAGAGATAGGG - Intergenic
1092306841 12:7310250-7310272 TTATTCCCATTTTACAGATAAGG + Intronic
1093171358 12:15864296-15864318 TGTTTCCCTTTTTAGAGATGAGG - Intronic
1093662307 12:21771572-21771594 TGTTTCCAATTTTAGTGATATGG + Intronic
1093705575 12:22271537-22271559 TTCACCCCATTTTATAGATGAGG - Intronic
1094063660 12:26341142-26341164 TGGTCCCCATTTTACAGATAAGG + Intronic
1094356069 12:29579017-29579039 TGCCTCCCATATTAGAGATGAGG + Intronic
1094424842 12:30306748-30306770 GGACTCCCATTTTACAGATAAGG - Intergenic
1094549085 12:31433280-31433302 TGCTTTCTATTTTAAAGATAAGG - Intronic
1094629829 12:32162496-32162518 TGATACCCATTTTATAGATATGG - Intronic
1095145770 12:38724097-38724119 TACTTCCCATTTTAGATAAAAGG + Intronic
1095709223 12:45270287-45270309 GCCATCCCATGTTATAGATAAGG + Intronic
1095933983 12:47657080-47657102 AGGATTTCATTTTAGAGATAAGG - Intergenic
1096253544 12:50049423-50049445 ATCATCCCATTTTATAGATGAGG - Intergenic
1096259167 12:50080376-50080398 AGCATCTCATTTTATGGATATGG + Intronic
1096684398 12:53278172-53278194 TGGCCCCTATTTTAGAGATAAGG - Intronic
1097354466 12:58586080-58586102 TGAATCCCATTTTGAAGATGAGG + Intronic
1098127806 12:67318385-67318407 TAATTCCCATTTTATAGATAGGG - Exonic
1098242132 12:68478950-68478972 TGAAACCCATTTTACAGATGAGG + Intergenic
1098263358 12:68694000-68694022 TTATTCCCATTTTAGAGAAAAGG + Intronic
1098386955 12:69929814-69929836 TCAATCCCATTTTAAAAATAGGG - Intronic
1098604775 12:72376911-72376933 CCAATCCCATTTTACAGATAAGG - Intronic
1098900169 12:76104151-76104173 TCATTCCCATTTTAGAGATGAGG + Intergenic
1099268290 12:80476916-80476938 TGACACCCATTTTATAGATAAGG + Intronic
1100362826 12:93894035-93894057 TTCTTCTCATTTTAGAGATGAGG + Intronic
1100403229 12:94250368-94250390 AACATCCCATTTCAGAGATGAGG + Intronic
1100532894 12:95476974-95476996 GCCATCTCATTTTACAGATAGGG + Intronic
1100557659 12:95712458-95712480 TTAATCCCATTATAGAGATCAGG - Intronic
1100620842 12:96271157-96271179 TATATACCATTTTACAGATAAGG + Intergenic
1100922383 12:99502664-99502686 TTATTCTCATTTTAGAGATAAGG - Intronic
1101227724 12:102706680-102706702 TTTAACCCATTTTACAGATAAGG + Intergenic
1101286653 12:103320651-103320673 TACATTCAATATTAGAGATATGG + Intronic
1101323048 12:103690228-103690250 TGATTCCCATTTTACAGATATGG + Intronic
1101408118 12:104446713-104446735 TGATTCCCATTTTACAGATGAGG + Intergenic
1101841967 12:108334117-108334139 TGGAACCCATTTGAGAGATGAGG - Intronic
1101845877 12:108362666-108362688 TGACTCCCATTTTACAGATGTGG - Intergenic
1101879094 12:108614325-108614347 AGCATCCCATGTTACAGATGAGG + Intergenic
1101954489 12:109201310-109201332 TGATGCCCATTTTACAGATATGG - Intronic
1102045119 12:109824949-109824971 TTACTCCCATTTTACAGATAAGG - Intronic
1102060570 12:109927842-109927864 TTCTTCCCATTTTTCAGATAAGG - Intronic
1102167439 12:110817925-110817947 TTAATCCTATTTTACAGATATGG - Intergenic
1102389815 12:112540408-112540430 TTCATCCCATTTTACAGTTGTGG - Intergenic
1102416267 12:112765587-112765609 TTCACTCCATTTTACAGATAAGG - Intronic
1102451700 12:113046781-113046803 TCATTCCCATTTTACAGATAAGG - Intergenic
1102462483 12:113108517-113108539 TGAGTCCCATTTTACAGATGAGG + Intronic
1102502960 12:113365272-113365294 TTCTTCCCATTTTACAGATGTGG - Intronic
1102545829 12:113654686-113654708 TTATTCCCATTTTACAGATATGG + Intergenic
1102582023 12:113895400-113895422 GGCAGCCCATTTCACAGATAAGG - Intronic
1102631343 12:114283575-114283597 GTCTTCCCATTTTACAGATAAGG + Intergenic
1102641215 12:114368497-114368519 TTGATCCCATTTTACAGATGAGG + Intronic
1102801489 12:115738624-115738646 TGTTTCCCATTTTACAGATAAGG - Intergenic
1102882336 12:116495232-116495254 TTCACCCCATTTTATGGATAAGG + Intergenic
1102932001 12:116869510-116869532 TTCTTCCCATTTTACAGATGAGG + Intronic
1103129498 12:118454843-118454865 CATATCCCATTTTAGAAATAAGG - Intergenic
1103147206 12:118605448-118605470 TGATTCCCATTTGACAGATAAGG + Intergenic
1103236074 12:119373686-119373708 CCCATCTCATTTTACAGATAAGG - Intronic
1103249641 12:119488552-119488574 TGTAGCCCATTTTACAGATGAGG - Intronic
1103894813 12:124265843-124265865 TGACACCCATTTTAGAGATAAGG + Intronic
1105526251 13:21180322-21180344 TTCATTTCATTTTAGAGATAGGG - Intergenic
1105795495 13:23848361-23848383 TGCATTTCTTTTTAGAGGTAAGG - Intronic
1106087067 13:26552210-26552232 TGTTGCCCATTTTATAGATAAGG - Intergenic
1106162625 13:27214643-27214665 TGCCTTCCCTTTTAGAGAAAAGG - Intergenic
1106492371 13:30238303-30238325 TTATTCCCATTTTATAGATAAGG + Intronic
1106894329 13:34281953-34281975 TGCATCTCATTTTAGTGGAAAGG - Intergenic
1107103235 13:36616844-36616866 TTCATTCCATTTCACAGATAAGG + Intergenic
1107909665 13:45093526-45093548 GGCTTCCCATTTTAAAGAGAAGG - Intergenic
1108418555 13:50225807-50225829 GTCATCCCATTTTACAGATATGG - Intronic
1108564539 13:51682629-51682651 TTACTCCCATTTTACAGATAAGG - Intronic
1109017131 13:57031064-57031086 TGCAGACCATTTGAGAGCTAAGG + Intergenic
1109439263 13:62348428-62348450 TCATTACCATTTTAGAGATAAGG + Intergenic
1110266056 13:73538748-73538770 TTCATCCCATTTTTCAGATGAGG - Intergenic
1111673936 13:91363730-91363752 TTATTCCCATTTTACAGATAAGG + Intergenic
1111805479 13:93035170-93035192 TCATTCCCATTTTAGAGAAATGG - Intergenic
1112119656 13:96395975-96395997 TTTTTCCCATTTTACAGATAAGG - Intronic
1112695428 13:101943073-101943095 TTAATCCCATTTTAGAGATGAGG + Intronic
1112734779 13:102403442-102403464 TTCATCATATTTTTGAGATAAGG + Intergenic
1113222865 13:108125423-108125445 ATCACCCCATTTTACAGATAAGG + Intergenic
1114240973 14:20867782-20867804 AGCATTCCCCTTTAGAGATATGG - Intergenic
1114597487 14:23925849-23925871 AGTATCCCATTTTACAGATGAGG + Intergenic
1114674500 14:24431329-24431351 TTATTCCCATTTTAGAGATAAGG - Intronic
1115083186 14:29481961-29481983 ATCATCCCCTTTTACAGATAAGG - Intergenic
1115213308 14:30989862-30989884 ATCATCCCATTTCATAGATATGG - Intronic
1115730445 14:36263027-36263049 TAATTCCCATTTTACAGATAGGG - Intergenic
1116409768 14:44607648-44607670 TTCTTCCCATTTTATAGATGGGG + Intergenic
1116802126 14:49453925-49453947 TGATTCCCATTTTATAGATGAGG - Intergenic
1117070377 14:52050571-52050593 TCCTTCCCATTTTACAGAGATGG - Intronic
1117180313 14:53184847-53184869 TTGTTCCCATTTTATAGATAAGG + Intergenic
1117220813 14:53603651-53603673 TTAATCCCATTTTACAGATGAGG + Intergenic
1117275982 14:54194013-54194035 TTACTCCCATTTTAGAGATAAGG + Intergenic
1117959214 14:61146666-61146688 TGTATCCCATTTTATAGAAAAGG - Intergenic
1118142144 14:63095758-63095780 TGATTCCCATTTTACAGATGAGG + Intronic
1118490156 14:66251011-66251033 GACATCCCATTTTACAGATAAGG - Intergenic
1118590515 14:67397446-67397468 TTCATCCCATTTTACAGATGAGG + Intronic
1118659729 14:67995518-67995540 TCCATCCCAAGTTAGAAATATGG + Intronic
1118813602 14:69293087-69293109 TCCAACCCATTTTACAGATGAGG + Intronic
1119167767 14:72509484-72509506 TGATTCCCATTTTCCAGATAGGG - Intronic
1119327300 14:73768248-73768270 TTTTTCCCATTTTATAGATAAGG + Intronic
1119359303 14:74034771-74034793 ACTATCCCATTTTACAGATAAGG - Intronic
1119515910 14:75248114-75248136 TGATTCCCATTTTACAGATGAGG + Intronic
1119647187 14:76356388-76356410 TCTCTCCCATTTTACAGATAAGG + Intronic
1119665911 14:76484856-76484878 TGATTCCCATTTTACAGACAAGG - Intronic
1119690423 14:76667396-76667418 CGTCTCCCATTTTAGAGATGAGG - Intergenic
1119850865 14:77865766-77865788 TGATTCCAATTTTAGAGATCGGG - Intronic
1119902435 14:78272798-78272820 TTCATCCTATTTTACAGATAAGG - Intronic
1120408420 14:84118418-84118440 TTATTCCCATTTTAAAGATAAGG - Intergenic
1120467312 14:84875434-84875456 TGGATCCCATTTTACAGTTGAGG - Intergenic
1120590255 14:86365644-86365666 TGTATTCCATTTTAAAGATAAGG - Intergenic
1120662261 14:87264426-87264448 TTCCTCCCTTTTTAGACATAGGG + Intergenic
1120821820 14:88918508-88918530 TTCTTCCTATTTTATAGATAAGG + Intergenic
1120920739 14:89753344-89753366 TTCATCCCAATTTAGAAATGAGG + Intergenic
1120997219 14:90426063-90426085 TTCATTTCATTTTAGAGACAGGG - Intergenic
1121126970 14:91414289-91414311 TACGTCCCATTTTACAGATGAGG + Intronic
1121414114 14:93767291-93767313 TGACTCCCATTTTACAGATCAGG + Intronic
1121495241 14:94387786-94387808 TGATTCCCATTTTACAGATGAGG - Intronic
1121735580 14:96215860-96215882 TCTATCCCATCTTACAGATAAGG + Intronic
1121776104 14:96592181-96592203 TTCTTCCCATTTTCCAGATAAGG - Intergenic
1121816889 14:96935533-96935555 TTATTCCCATTTTAGAGATGAGG + Intergenic
1124846331 15:33294742-33294764 TTATTCCCATTTTACAGATAGGG + Intergenic
1124888865 15:33713073-33713095 TGAATCACCTTTTAGACATAAGG - Intronic
1124934028 15:34152586-34152608 TTCATCCCATCTTAGAGAAATGG + Intronic
1125453076 15:39829031-39829053 TCTATCCCATTTTAAAAATAAGG + Intronic
1125539747 15:40463444-40463466 TTAATCCCATTTTACAGATGTGG + Intronic
1125927543 15:43575409-43575431 TTCCTCCCATTTTACAGATGAGG - Intronic
1125940686 15:43674974-43674996 TTCCTCCCATTTTACAGATGAGG - Intergenic
1126909830 15:53406068-53406090 TTATTCCCATTTTACAGATAAGG - Intergenic
1127141685 15:55984365-55984387 TTACCCCCATTTTAGAGATAAGG - Intronic
1127194910 15:56573674-56573696 TGCATCCCTTTGTAGGGACATGG - Intergenic
1127725729 15:61747730-61747752 AAGATCCCATTTTACAGATAAGG - Intergenic
1127862849 15:63008848-63008870 ACCAGCCCATTTTAGAGATGAGG + Intergenic
1127883873 15:63182066-63182088 TTCCTCCCATTTTACAGTTAAGG + Intergenic
1128703975 15:69825208-69825230 TGGAACCCATTTTACAGATGAGG - Intergenic
1128713062 15:69886347-69886369 TTCATCCCATTTCACAGATGGGG - Intergenic
1128795946 15:70466699-70466721 TGATTCCCATTTTAGAGACAGGG + Intergenic
1129120102 15:73391089-73391111 TTCACCCCATTTTATAGATGAGG - Intergenic
1129180045 15:73868422-73868444 AGCACCCCCTTTTACAGATAAGG + Intergenic
1129517888 15:76167920-76167942 TGATTCCCATTTTACAGAAAGGG - Intronic
1129645611 15:77428622-77428644 TTAATCCCAATTTATAGATAAGG + Intronic
1129682672 15:77666686-77666708 AGCATTCCATTTTATAGAGAAGG - Intronic
1129878169 15:78990500-78990522 TGATTCCCATTTTACAGATAAGG - Intronic
1130046182 15:80446658-80446680 TTCATCCCATTTTACAGATTAGG - Intronic
1130200953 15:81826385-81826407 TGCAACCCATTTTACAGATTTGG + Intergenic
1130207495 15:81890464-81890486 TGATTCCCATTTTATAGATGAGG - Intergenic
1130306364 15:82714538-82714560 TACTTCCCATTTTACAGATGGGG + Intergenic
1130652534 15:85770241-85770263 TAAGTCCCATTTTAGAGCTAGGG + Intronic
1130866955 15:87941319-87941341 TTAATCCCATTTTACAGATGAGG - Intronic
1131257197 15:90870833-90870855 TTAATCCCATTTTACAGATAAGG - Intronic
1131747326 15:95463119-95463141 TTAGTTCCATTTTAGAGATAAGG + Intergenic
1132257693 15:100391767-100391789 TGATTCCCATTTCAGAGAAATGG + Intergenic
1133150031 16:3821128-3821150 TGCTTCCTATTTTATAGATAAGG - Intronic
1133669148 16:8000420-8000442 TGAATCCCATTTTACAAATGTGG - Intergenic
1133710698 16:8398264-8398286 TCCTTCCCATTTTACAGAAAGGG + Intergenic
1133806360 16:9128488-9128510 GGGAGCCCATTTTAGAGATGGGG - Intergenic
1133878331 16:9756616-9756638 TTGCTCCCATTTTACAGATAAGG - Intronic
1134282436 16:12829702-12829724 TGATACCCATTTTACAGATAGGG - Intergenic
1134301984 16:13000243-13000265 GTTATCCCATTTTAGAGATGGGG - Intronic
1134434741 16:14246075-14246097 TTCTTCCCATTTTACAGATCGGG - Intronic
1134680447 16:16121354-16121376 TTGTTCCCATTTTACAGATAAGG + Intronic
1134757608 16:16682074-16682096 TTAATCCCATTTTACAGATAGGG - Intergenic
1134827587 16:17296912-17296934 TTGATTCCATTTTACAGATAAGG - Intronic
1134853918 16:17504206-17504228 TTAATCCCATTTTACAGATGAGG + Intergenic
1134914901 16:18061268-18061290 TTCATCCCATTTTAGAGATGAGG + Intergenic
1134988460 16:18677092-18677114 TTAATCCCATTTTACAGATAGGG + Intergenic
1135041988 16:19124592-19124614 TTAATCCCATTTTACAGATGAGG - Intronic
1135231353 16:20711186-20711208 TTATTCCCATTTTACAGATAAGG + Intronic
1135285168 16:21187137-21187159 TACCTCCCATTTTAGAGATAAGG + Intergenic
1135772028 16:25225031-25225053 TGTCTCCCGTTTTATAGATAAGG + Intronic
1135816258 16:25636819-25636841 TTATTCCCATTTTACAGATAAGG + Intergenic
1135984796 16:27176198-27176220 ATCATCCCATTTTACAGATGAGG - Intergenic
1136114600 16:28086900-28086922 TGACTCCCATTTTACAGATGAGG + Intergenic
1136549569 16:30975744-30975766 TGATTCCCATTTTATAGATGAGG + Intronic
1138199101 16:55075813-55075835 TTGCTCCCATTTTATAGATAGGG + Intergenic
1138250567 16:55498832-55498854 TTCCTCCCATTTTACAGATGAGG + Intronic
1138481086 16:57303875-57303897 TGCACATCATTTTAGAGAGAAGG + Intergenic
1138489746 16:57369853-57369875 TGCATCCCATTTTACATATAGGG + Intergenic
1139060528 16:63245304-63245326 TCCTTCCCATGTTAGAGAAATGG + Intergenic
1139986674 16:70904277-70904299 ATCACCTCATTTTAGAGATAAGG - Intronic
1140464442 16:75168470-75168492 TCCATTCCTATTTAGAGATAGGG - Intronic
1140667627 16:77242052-77242074 TGTTACCCATTTTACAGATAAGG - Intergenic
1140763840 16:78137381-78137403 TGGTTCCCATTTTACAGATGAGG - Intronic
1140892376 16:79296119-79296141 ATAATCCCATTTTACAGATAAGG - Intergenic
1140909291 16:79437493-79437515 TGCATCCCATTTTACAGTGAGGG + Intergenic
1141327274 16:83073107-83073129 TGAACCCCATTTTACAGGTAAGG + Intronic
1141369537 16:83474282-83474304 GTCAGCCCATTTTACAGATAAGG + Intronic
1141717806 16:85736747-85736769 CTCATCCCATTTTAAAGATGAGG - Intronic
1141764360 16:86048809-86048831 TTATTCCCATTTTAGAGATAGGG + Intergenic
1141916597 16:87101725-87101747 TAGATCCCATCTTATAGATAAGG + Intronic
1142655029 17:1386081-1386103 TACTACCCATTTTACAGATAAGG - Intronic
1143114419 17:4574605-4574627 TGATCCCCATTTTACAGATAAGG + Intergenic
1143222638 17:5275476-5275498 TTATTCCCATTTTAGAGATAAGG + Intergenic
1143687726 17:8532444-8532466 TGTCTTCCATTTAAGAGATACGG - Intronic
1143883301 17:10047000-10047022 TGCATCTCAAATTAGAGACATGG - Intronic
1144178593 17:12731639-12731661 TGATTCCCATTTTATAGATGGGG + Intronic
1144796615 17:17895826-17895848 ATCATCCCATTTTAGAGATGAGG + Intronic
1145736923 17:27239675-27239697 TTCTTCCCATTTTACAGACAGGG + Intergenic
1145905716 17:28515059-28515081 ATCATCCCATTTTATAGATGAGG - Intronic
1146087231 17:29840841-29840863 TTATTCCCATTTTATAGATAGGG + Intronic
1146918415 17:36692991-36693013 ATTATCCCATTTTATAGATAAGG - Intergenic
1147568942 17:41555352-41555374 TGAAGCCCATTTTATAGATGAGG - Intergenic
1147883805 17:43670892-43670914 TGCTCCCCATTTTACAGATCAGG + Intergenic
1148048311 17:44757534-44757556 TGCTCCCCATTTTACAGATGGGG - Intergenic
1148150608 17:45394722-45394744 ACCATCCCATTTTACAGACAAGG - Exonic
1148511596 17:48175544-48175566 CGCATCCTATTTCAGTGATATGG + Intronic
1148800425 17:50221501-50221523 TGATCCCCATTTTAGAGATGAGG - Intergenic
1149207982 17:54270562-54270584 TTATTCTCATTTTAGAGATAAGG + Intergenic
1149423300 17:56531298-56531320 TGAAACCCATTTTACAGATGAGG + Intergenic
1149434365 17:56620573-56620595 TGCACCTCATTTTACAGATGAGG + Intergenic
1149596325 17:57866796-57866818 TCCATCCCATTTTATAGATGAGG - Intronic
1150214432 17:63458791-63458813 TGATTCCCATTTTTCAGATAAGG - Intergenic
1150247423 17:63686978-63687000 ACCATCCCATTTTGGAGATGGGG - Intronic
1150439788 17:65181787-65181809 TGCTTCCCCTGTTAGAGATGAGG - Intronic
1150470907 17:65436802-65436824 TTCATCTCATTTTTCAGATAAGG + Intergenic
1150626267 17:66843136-66843158 TGATTCCCATTTTACAGATGAGG + Intronic
1151174981 17:72280672-72280694 TTACACCCATTTTAGAGATAAGG + Intergenic
1151705216 17:75763764-75763786 AGCATCCCATTGTACAGATGAGG - Intronic
1151746574 17:76014782-76014804 GTTATCCCATTTTAGAGATGAGG + Intronic
1151774829 17:76193179-76193201 TAAATCTCATTTTACAGATAAGG - Intronic
1152007117 17:77689318-77689340 TGCTTCCCATTTTGCAGAAAAGG + Intergenic
1152007122 17:77689380-77689402 TTCAGCCCATTTTACAGACAAGG + Intergenic
1152007127 17:77689442-77689464 TTCAGCCCATTTTACAGACAAGG + Intergenic
1152007132 17:77689504-77689526 TTCAGCCCATTTTACAGACAAGG + Intergenic
1152007137 17:77689566-77689588 TTCAGCCCATTTTACAGACAAGG + Intergenic
1152248634 17:79199853-79199875 TTCTCCCCATTTTATAGATAAGG - Intronic
1153338080 18:3945136-3945158 TCATTCCCATTTTAGAGAGAGGG - Intronic
1153512176 18:5867939-5867961 TTATTCCCATTTTATAGATAAGG - Intergenic
1153687293 18:7558958-7558980 TGATGCCCATTTTAGAGATGAGG - Intergenic
1154306849 18:13236910-13236932 TCCATCTCAGTTTAGAGATGAGG + Intronic
1154412780 18:14150341-14150363 CTCATCCCATTTTACAGACAGGG + Intergenic
1155482977 18:26309749-26309771 TCACTCCCATTTTACAGATAAGG + Intronic
1155848506 18:30739892-30739914 TGGATACCATTTTAGACATGGGG + Intergenic
1156058587 18:33044152-33044174 TAAATGCCATTTTACAGATAAGG - Intronic
1156446243 18:37239175-37239197 TTATCCCCATTTTAGAGATAAGG + Intergenic
1156496227 18:37526962-37526984 TACTGCCCATTTTATAGATAAGG - Intronic
1157083882 18:44557167-44557189 TTAATCCCATTTTACAGATGAGG - Intergenic
1157159572 18:45301171-45301193 AGCATTCCACTTTAGAGATCAGG + Intronic
1157308740 18:46536109-46536131 ATCATCCCATTTTACAGATGAGG - Intronic
1157487524 18:48099124-48099146 TGAATCCTATTTTATTGATAAGG - Intronic
1158307074 18:56117506-56117528 TTCACCCCATTTTAGAAATGTGG - Intergenic
1158571067 18:58597464-58597486 TCATTCCCATTTTACAGATACGG + Intronic
1158800655 18:60904648-60904670 TGGTTCCCATTTTATAGATGAGG + Intergenic
1158944543 18:62437118-62437140 TTATTCCCATTTTAGAGATGGGG + Intergenic
1159512841 18:69418465-69418487 AGCTTTCCTTTTTAGAGATAGGG + Intronic
1159863615 18:73679015-73679037 ACCATCCCATTTTACAGAGAAGG + Intergenic
1159993333 18:74936758-74936780 ACCATCCCATTTCAGAAATATGG + Intronic
1160212990 18:76899089-76899111 TGCTTCCCACTTTAAACATACGG + Exonic
1160417909 18:78724502-78724524 TTAATCCCAATTTAGAGATGAGG + Intergenic
1161488244 19:4547552-4547574 TTCCTCCCATTTTAGAGACGGGG + Intronic
1161656728 19:5520726-5520748 TGAACCCCATTTTATAGATGAGG + Intergenic
1161785254 19:6320784-6320806 TGCTCCCCATTTTACAGATGGGG - Intronic
1162323702 19:9986087-9986109 TTCATCCCATTTTACAGACAAGG - Intronic
1162467479 19:10850903-10850925 TTCTTCCCATTTTGCAGATAAGG + Intronic
1163059316 19:14746988-14747010 TGCATCAGTTTTTGGAGATATGG + Intronic
1163221785 19:15927068-15927090 TTATTCCCATTTTACAGATAGGG + Intronic
1163665196 19:18599957-18599979 TGTCCCCCATTTTACAGATAGGG + Intronic
1163675318 19:18652894-18652916 ATCATCCCATTTTACAGATGGGG + Intronic
1164049678 19:21574148-21574170 TGCATTGCATTTTAGAGACAGGG - Intergenic
1164411074 19:28005854-28005876 TGAATCTTATTTTTGAGATACGG + Intergenic
1165683150 19:37794749-37794771 TGCATCCCATTTTTTAAAAATGG + Intronic
1165700150 19:37931379-37931401 TTCATCCCATTTCATAGATGAGG + Intronic
1165802923 19:38563912-38563934 TTCTTCCCATTTTATAGATGAGG - Intronic
1165954308 19:39492437-39492459 ATCACCCCATTTTAGAGATGAGG - Intronic
1166075771 19:40413092-40413114 ATCAGCCCATTTTAGAGATGGGG + Intronic
1166124358 19:40704965-40704987 TGATTCCCATTTTACAGATGGGG + Intronic
1166176928 19:41080659-41080681 TTCTTCTAATTTTAGAGATAGGG + Intergenic
1166188867 19:41161936-41161958 TGATTCCCACTTTACAGATAAGG - Intergenic
1166376924 19:42332893-42332915 TATATCCCACTTTAGAGATGAGG + Intronic
1166665133 19:44675041-44675063 TCTATGCCATTTTACAGATAAGG - Intronic
1167535365 19:50047352-50047374 TGATGCCCATTTTACAGATAAGG - Exonic
1167563483 19:50240925-50240947 TGCTTCCCATGTTACAGATAGGG - Intronic
1167693023 19:50998858-50998880 TGATTCCCATTTTGCAGATAAGG + Intronic
1167779783 19:51591610-51591632 TAAACCCCATTTTAGAGATGAGG + Exonic
925210870 2:2044839-2044861 TGCATCCCAAAATAGAGGTAGGG - Intronic
925918669 2:8624809-8624831 TGTGACCCATTTTAGAGATGAGG - Intergenic
925988378 2:9234277-9234299 TGCCTCCCATTTTACAGTTTAGG - Intronic
926988718 2:18653162-18653184 TTCATCCCATTGTAAAAATAAGG - Intergenic
927012289 2:18916818-18916840 TTTATTCCATTTTACAGATAAGG + Intergenic
927356242 2:22176968-22176990 ATCACCCCATTTTAGAGATACGG + Intergenic
927408446 2:22798314-22798336 TGAGTTCCATTTTATAGATATGG + Intergenic
927559617 2:24060729-24060751 GGCATTCCATTTTAGACATGTGG + Intronic
927605967 2:24487233-24487255 AGCATCCTATTTTACAGATGGGG + Intergenic
927707288 2:25304284-25304306 ATCATCCCATTTTATAGATGAGG - Intronic
927835734 2:26397203-26397225 TTGATCCCATTTTATAGATGAGG - Intergenic
927917565 2:26946772-26946794 TCCATCCCATCTTATAGATGAGG - Intronic
927918016 2:26948975-26948997 TTCTTCCCATTTTACAGATGAGG + Exonic
928392326 2:30919098-30919120 TCCATCCCAATTTAAAGAAAGGG - Intronic
928451130 2:31379566-31379588 TGGTGCCCATTTTACAGATAAGG + Intronic
928621257 2:33090572-33090594 TGGTTCCCATTTTAGAGATAGGG + Intronic
929765189 2:44838284-44838306 TGCTTCCCATATTACAGCTAGGG + Intergenic
929823754 2:45293825-45293847 TGAACACCATTTTATAGATAAGG - Intergenic
929881705 2:45842557-45842579 GTTATCCCATTTTACAGATATGG - Intronic
929941764 2:46339499-46339521 TCATTCCCATTTTAGAGATAAGG - Intronic
930088603 2:47516046-47516068 ATCATCCCACTTTAGAGATGAGG + Intronic
930270957 2:49256237-49256259 TTTTTCCCATTTTAGAGATGAGG + Intergenic
930390480 2:50755302-50755324 TTCATTCCATTTTACAAATAAGG - Intronic
931148413 2:59545335-59545357 TTATTCCCATTTTATAGATAAGG - Intergenic
931151969 2:59584585-59584607 TTATTCCCATTTTACAGATAAGG + Intergenic
931419933 2:62117581-62117603 TTTATCCCATTTTACAGATGAGG - Intronic
931698044 2:64886672-64886694 TTATTCCCATTTTAGAGATGAGG - Intergenic
931924172 2:67053231-67053253 GGCATCCCATTATTGAGATTAGG + Intergenic
932221533 2:70003310-70003332 ATCATCCCATTTTACAGATGAGG - Intergenic
932680387 2:73819478-73819500 TTCATCCCATTTCACAGATAAGG + Intergenic
933243421 2:79948425-79948447 TTATTCCCATTTTATAGATAAGG - Intronic
933292864 2:80456717-80456739 TGCTTCCCATTTTATAGCTAAGG - Intronic
935178400 2:100669501-100669523 TTAATCCCATTTTATAGATGAGG + Intergenic
935814952 2:106838672-106838694 TTGTTCCCATTTTACAGATAAGG - Intronic
936155537 2:110044319-110044341 TCAATTCCACTTTAGAGATAAGG + Intergenic
936189149 2:110327115-110327137 TCAATTCCACTTTAGAGATAAGG - Intergenic
936414075 2:112288498-112288520 TTCATCCCATTTTGTAGACAAGG + Intronic
936765692 2:115845874-115845896 TGTTTCCCATTTTACAGATAAGG + Intergenic
937225955 2:120368768-120368790 TATATCCCATTTCACAGATAAGG - Intergenic
938228655 2:129639050-129639072 TACTTCCCATTTTACATATAAGG - Intergenic
939081279 2:137664622-137664644 ATCATCCCATTTGAGAGATGAGG + Intronic
939142701 2:138374931-138374953 TCATTCCCATTTTATAGATAAGG + Intergenic
939377909 2:141393912-141393934 TGTATTCACTTTTAGAGATATGG + Intronic
939519422 2:143210860-143210882 TGCATCCAACTTTAGATATTTGG + Intronic
939616679 2:144369142-144369164 TCCATCCCATTTTAACCATATGG - Intergenic
940863834 2:158797228-158797250 TGCATCCTGTTTCAGAGATGAGG - Intronic
941109383 2:161401948-161401970 TTAACCTCATTTTAGAGATAAGG - Intronic
941198443 2:162478874-162478896 TGCATCCCGTTTTAGAGAGCAGG + Intronic
941981156 2:171458746-171458768 TGCAACTCATTTTGCAGATAAGG - Intronic
942826333 2:180181325-180181347 TTTATCCCATTTTATAGATGAGG - Intergenic
944029526 2:195217136-195217158 TGCATTCCATTTAACAGAAAAGG - Intergenic
944215093 2:197246801-197246823 TTCTTTCCATTTTAGAGATGAGG + Intronic
944341945 2:198611663-198611685 ATTTTCCCATTTTAGAGATAAGG - Intergenic
944654927 2:201867892-201867914 TGATTCCCATTTTACAGATTTGG + Intronic
945236467 2:207636273-207636295 TGAACCCCACTTTAGAGATGAGG + Intergenic
946088703 2:217200017-217200039 CGCATGCCATTTTACAGAGAGGG + Intergenic
946147864 2:217744394-217744416 TCATTCCCATTTTACAGATAAGG + Intronic
946172879 2:217905809-217905831 TGCCTCCCATTTTGGGGAGAGGG - Intronic
946181437 2:217951467-217951489 TGAATCCCATTTTACAGAGGAGG + Intronic
946332901 2:219020382-219020404 TTCATTTCATTTTTGAGATAGGG + Intronic
946463700 2:219892612-219892634 TGATTCCCATTTTACAGATGAGG - Intergenic
946624162 2:221593078-221593100 GTCAGCCCATTTTACAGATAGGG + Intergenic
947280530 2:228447788-228447810 AGCATCTCATTCTATAGATAAGG - Intergenic
947393363 2:229662771-229662793 TGCATCCCACTTTGCAGATTTGG - Intronic
947510650 2:230750837-230750859 CTTTTCCCATTTTAGAGATAAGG + Intronic
947526119 2:230877756-230877778 TGCTGCCCATTTTAAAGATGAGG + Intronic
948400218 2:237678949-237678971 TCCCTCCCATTTTACAGATGAGG + Intronic
1168764650 20:373445-373467 TCAATCCCACTTTATAGATAGGG + Intronic
1168949848 20:1789709-1789731 TGATTCCCATTTTAAAGATGAGG - Intergenic
1169264656 20:4160508-4160530 TGCTGCCCATTTTACAGATGAGG - Intronic
1169356636 20:4912473-4912495 TTATTCCCATTTTAGAGACAGGG + Intronic
1170896654 20:20421044-20421066 TGCAAACCATTTAAGTGATAAGG + Intronic
1171957722 20:31472752-31472774 AGAATCCCATTTTATAGATTAGG + Intronic
1172115912 20:32573615-32573637 GTCATCCCATTTTACAGATGAGG + Intronic
1172182679 20:33013149-33013171 TTCATCCCATTTTACAGATGAGG - Intronic
1172288273 20:33756834-33756856 TGAGTCCCATTTTACAGATGTGG + Intronic
1172565535 20:35927410-35927432 TGTATCCCATTTTGCAGATGGGG + Intronic
1172634273 20:36399362-36399384 TGGGTCTCATTTTATAGATAAGG - Intronic
1172906464 20:38373770-38373792 TTCTTTCCATTTTACAGATAAGG - Intronic
1173000788 20:39104201-39104223 TGTATCCCATTTTATAGGCAAGG + Intergenic
1173194182 20:40900375-40900397 TGAATCCCGTTTTACAGATGAGG - Intergenic
1173473266 20:43339643-43339665 GGTATCCCAATTTATAGATAAGG - Intergenic
1173542634 20:43866263-43866285 TTCTTCCCATTTGACAGATAAGG + Intergenic
1173650619 20:44661673-44661695 TTCTTCCAATTTTATAGATAAGG - Intergenic
1173667099 20:44770984-44771006 TTAATCCCATTTTACAGATGAGG + Intronic
1173721383 20:45261065-45261087 TATATCCCATTTTAAAGAAAAGG + Intergenic
1173804996 20:45918923-45918945 ATCATCCCATTTTACAGATGTGG - Intergenic
1173948790 20:46974088-46974110 TTAATCCCATTTTACTGATAAGG - Intronic
1174268037 20:49345999-49346021 TGAATCCCATTTTCCAGATGAGG - Intergenic
1174282380 20:49448567-49448589 TTCTTCCCATTTTAGAGATGAGG + Intronic
1174345266 20:49924408-49924430 TTAATCCCATTTTACTGATAAGG - Intergenic
1174371891 20:50095971-50095993 TGCATTCCATTTCACAGATGAGG - Intronic
1174413914 20:50354604-50354626 GTCATCCCATTTTAAAGATGAGG - Intergenic
1174565913 20:51464347-51464369 TTCTCCCCATTTTACAGATAGGG + Intronic
1174718438 20:52785094-52785116 ACCATCCCATTTTACAGATATGG - Intergenic
1174760059 20:53198436-53198458 TTAATCCCATTTTGCAGATAGGG + Intronic
1174780253 20:53382906-53382928 GGTATCCCATTTTGCAGATAAGG - Intronic
1175027639 20:55919358-55919380 TGGTTCTCATTTTAGATATAGGG + Intergenic
1175214152 20:57381665-57381687 TGTCTCCCATTTTACAGATGAGG - Intergenic
1175261163 20:57675095-57675117 ATCATCCCATTTTTGGGATAAGG + Intronic
1175269388 20:57723225-57723247 TCCCTCTCATTTTACAGATAAGG - Intergenic
1176860226 21:14007914-14007936 CTCATCCCATTTTACAGACAGGG - Intergenic
1177056859 21:16316946-16316968 TTCCACCCATTTTATAGATAAGG - Intergenic
1177287440 21:19070845-19070867 TGCAGCACATTTTAGAGCAAAGG - Intergenic
1177821194 21:26032543-26032565 TCCATCCCATGTTAAAGATGAGG - Intronic
1177964908 21:27715764-27715786 TTCATCCCACTTTAGAATTATGG + Intergenic
1178185235 21:30211139-30211161 TGACTCCCATTTTACAGATGAGG + Intergenic
1178492806 21:33064079-33064101 TTACTCCCATTTTAGAGATGAGG + Intergenic
1178684294 21:34699109-34699131 TTCATCCCATTTTATAAACAAGG - Intronic
1178761869 21:35411007-35411029 TTTATCCCATTTTATGGATAAGG + Intronic
1178796585 21:35750619-35750641 TCATTCCCATTTTACAGATAAGG + Intronic
1178961609 21:37071812-37071834 AACATTCCATTTTACAGATAAGG - Intronic
1179170170 21:38966899-38966921 TGATTCCCATTTTATAAATAAGG + Intergenic
1179178761 21:39027780-39027802 TTGAACCCATTTTACAGATAAGG + Intergenic
1181775853 22:25159668-25159690 AGCTTCCCATTTTACAGATAGGG + Intronic
1181906822 22:26204466-26204488 ATCACCCCATTTTACAGATAAGG + Intronic
1182068281 22:27445587-27445609 TGAGACCCATTTTACAGATAGGG + Intergenic
1182263342 22:29092329-29092351 AGTACCCCATTTTACAGATAAGG - Intronic
1182773224 22:32810962-32810984 TTCCCCCCATTTTAGAGATGAGG - Intronic
1183253508 22:36746132-36746154 ACCATCCCATTTTACAGATGGGG + Intergenic
1183304862 22:37077192-37077214 CTCATCCCATTTTACAGATGAGG + Intronic
1183323139 22:37177253-37177275 TGCATCTGATATTACAGATAAGG + Intergenic
1183360767 22:37382093-37382115 TGCCTCCCATTTTACAGGCAAGG + Intronic
1183834232 22:40439029-40439051 AATATCCCATTTTATAGATAAGG + Intronic
1183989042 22:41585794-41585816 TTCAGCCCATTTTAAAGATGAGG + Intronic
1184147573 22:42620257-42620279 TGAATCCCATTTTACAGATGTGG + Intronic
1184405878 22:44300528-44300550 GTCATCCCATTTTATAGATGAGG - Intronic
1184700716 22:46170818-46170840 TGCATCCCATTCTACACATTTGG - Intronic
1184767888 22:46581345-46581367 TTCACCCCATTTTACAGATGAGG + Intronic
949438059 3:4050399-4050421 TTATTCCCATTTTACAGATAAGG - Intronic
949537279 3:5005725-5005747 CCAATCCCATTTTAGAGATGGGG - Intergenic
949623464 3:5842833-5842855 TCATTCCCATTTTACAGATAAGG + Intergenic
949845004 3:8360906-8360928 TGAATCCCACTGTAGAGATTAGG + Intergenic
949904917 3:8851300-8851322 TGATTGCCATTTTAGAGATGAGG - Intronic
949921614 3:9007723-9007745 TCATTCCCATTTTATAGATAAGG + Intronic
950126780 3:10514551-10514573 AGCTTTCCATTTTACAGATAGGG + Intronic
950158422 3:10741264-10741286 TTTATCCCAATTTAGAGATGGGG + Intergenic
950279461 3:11694068-11694090 TTAGTCCCATTTTATAGATAAGG - Intronic
950389625 3:12686370-12686392 ATCATCCCATTTTACAGATGAGG + Intergenic
950452091 3:13071280-13071302 AGAACCCCATTTTAGAGATGGGG - Intronic
950525435 3:13520223-13520245 TCCACCCCATTTTACAGATAGGG - Intergenic
950549875 3:13659755-13659777 TTCACCCCATTTTACAGATAAGG - Intergenic
950659185 3:14456120-14456142 TTCACCCCATTTTACAGATAGGG - Intronic
950706182 3:14783941-14783963 ATCATCCCATTTTATAGATAAGG - Intergenic
950726618 3:14921181-14921203 TTCATCACATTTTAGGGACATGG + Intronic
950866538 3:16194164-16194186 TTACTCCCATTTTACAGATAAGG - Intronic
950936438 3:16843903-16843925 TCAATCCCATTTTACAGATGAGG - Intronic
951210922 3:19973993-19974015 TGCATACCAATTTGGAAATAGGG + Intronic
951421525 3:22491748-22491770 TCAATCTCATTCTAGAGATAAGG + Intergenic
951710410 3:25580884-25580906 TTCAGCCCATTTCACAGATAAGG - Intronic
952158245 3:30667108-30667130 TAAACCCCATTTTACAGATAGGG - Intronic
952436844 3:33279834-33279856 TTTATCCTATTTTAGAGATGAGG + Intronic
952584906 3:34879718-34879740 TTCACCCCATTTTGGAGATCTGG - Intergenic
952598374 3:35047082-35047104 TACATCCAATGTTAGAGATAAGG + Intergenic
952958046 3:38571594-38571616 TTAATCCTATTTTACAGATATGG - Intronic
953297905 3:41739487-41739509 TGCATCTCAGTTTAAACATAGGG - Intronic
953459569 3:43071865-43071887 TTGATCCCATTTGACAGATAAGG + Intergenic
953741838 3:45545121-45545143 CCCATCCCATTTTACAGATAGGG - Intronic
953781642 3:45876665-45876687 ATCATCCTATTTTATAGATAAGG + Intronic
953916841 3:46925836-46925858 ATCATCCCATTTGACAGATAAGG + Intronic
954338402 3:49934134-49934156 TGCCTCCCCTTTTATAGTTAAGG - Intergenic
955137172 3:56231038-56231060 TTACTCCCATTTTACAGATATGG + Intronic
955333319 3:58065319-58065341 TGACTCCCATTTTGGAGATGAGG - Intronic
955407513 3:58634782-58634804 TACATCCCATTCTACAGATGGGG + Intronic
955712504 3:61795114-61795136 AGTATCCCATTTTACAGATGAGG + Intronic
955856264 3:63277224-63277246 TTATTCCCATTTTAGAGATGAGG - Intronic
955976332 3:64484064-64484086 CTCACCCCATTTTAGAGATGAGG + Intergenic
956001031 3:64730362-64730384 TTACTCCCATTTTACAGATAAGG + Intergenic
956075984 3:65506209-65506231 TTATTCCCATTTTAGAGATGAGG - Intronic
956210466 3:66796422-66796444 TTCACCCCATTTTACAGATGAGG - Intergenic
956855165 3:73268929-73268951 TTCTTCCCATTTTAGAAATGAGG - Intergenic
957420472 3:79961656-79961678 TTCATCCCATTCCAGAGACAAGG - Intergenic
958562568 3:95765801-95765823 TCCATTTTATTTTAGAGATAGGG - Intergenic
958631701 3:96692620-96692642 TGAATCTAATTTTAGAGATTTGG - Intergenic
959576619 3:107941173-107941195 TTCAACCCATTTTATAAATAAGG + Intergenic
960848294 3:122024696-122024718 TCAATCCCATTTTATAGATGTGG + Intergenic
961126098 3:124419387-124419409 TGATTCCCATTTTACAGACAAGG + Intronic
961677472 3:128576469-128576491 TGAGTCCCATTTTACAGATAAGG + Intergenic
963873445 3:150445728-150445750 TGTATCCCATTTTATAGTTGAGG + Intronic
964330660 3:155598724-155598746 TTATTCCCATTTTATAGATAAGG - Intronic
964614424 3:158647135-158647157 TTGTCCCCATTTTAGAGATAAGG - Intronic
964722624 3:159782266-159782288 TTCATCCCATTTTATAGACAGGG + Intronic
964851117 3:161097191-161097213 TTGCTCCCATTTTACAGATAAGG - Intronic
964967310 3:162512044-162512066 TTCATCTCATTTTACAGATTAGG + Intergenic
965371977 3:167874375-167874397 TCCATCCCATTTTACAGATGAGG - Intergenic
965430698 3:168584245-168584267 TTTGTCCCATTTTAGAGATGTGG - Intergenic
965431341 3:168592995-168593017 TCATTCCCATTTTAGAGATGTGG - Intergenic
966210448 3:177447958-177447980 TGATTCCCATTTTACAGATGTGG - Intergenic
966554594 3:181244772-181244794 AGTATCCCATTTTATAGATTAGG + Intergenic
966576231 3:181505778-181505800 TGAATCCCCTGTTAGAGAAAAGG - Intergenic
966812737 3:183862353-183862375 TGTCTCCCTTTTTACAGATAAGG - Intronic
966900859 3:184483245-184483267 TTATTCCCATTTTACAGATAAGG - Intronic
967280167 3:187814725-187814747 TTCTTCCCATTTTATAGATAAGG + Intergenic
967290962 3:187919931-187919953 TTCTTCCCATTTTAGAGATGGGG + Intergenic
967507964 3:190274922-190274944 TGAATACCATTTTAAAGAAAAGG - Intergenic
967807613 3:193729509-193729531 TCATTCCCATTTTACAGATAAGG + Intergenic
968068048 3:195769870-195769892 TGCTCCCCATTTTACAGATGAGG - Intronic
968135200 3:196215662-196215684 TTATTCCCATTTTACAGATAAGG - Intronic
968181058 3:196595552-196595574 CGCCCCCCATTTTACAGATAAGG - Intergenic
968574758 4:1360440-1360462 TCCACCCCATTTTACAGACAGGG + Intronic
968637186 4:1686645-1686667 TCCTCCCCATTTTACAGATAAGG + Intergenic
969131927 4:4996418-4996440 TGAACCCCATTTTACAGATGTGG + Intergenic
969178593 4:5420072-5420094 TTCTTTCCATTTTAGAGTTAAGG + Intronic
969207372 4:5656946-5656968 TGCATCCCATTGTATAGGTAAGG + Intronic
969233385 4:5847800-5847822 TTATTCCCATTTTATAGATAGGG - Intronic
969318111 4:6394280-6394302 TGAAACCCATTTTAGAGATTAGG - Intronic
969483559 4:7459440-7459462 TAAAGCCCATTTTACAGATAAGG - Intronic
969827939 4:9772927-9772949 TGGATGCCATTTTAAAGATGAGG + Intronic
970279497 4:14438591-14438613 TGAACCCCATTTTATAAATAAGG - Intergenic
970635714 4:18007221-18007243 TTCATCCTACTTTATAGATAAGG - Intronic
970867719 4:20778265-20778287 TTAGTCCCATTTTACAGATAAGG - Intronic
970910263 4:21266983-21267005 GTCATCTCATTTTACAGATAAGG - Intronic
971041397 4:22756297-22756319 TTAGTCCCATTTTACAGATAAGG - Intergenic
971143992 4:23956684-23956706 TGCATTGTATTTTAGAGAGAAGG - Intergenic
971291948 4:25350888-25350910 GTTATCCCATTTTACAGATAGGG - Intronic
971389674 4:26174254-26174276 TTGGCCCCATTTTAGAGATAAGG - Intronic
971458800 4:26871977-26871999 TGCATCCCATTTTAGAGATAAGG - Intronic
971708631 4:30081982-30082004 TGCATGCCATTTAAGAAATCTGG + Intergenic
972142224 4:35974936-35974958 TTCATCTCATTTTACAGATAAGG - Intronic
972143580 4:35992869-35992891 TGCCTCCCAATTTATAAATATGG - Intronic
972742354 4:41899578-41899600 TTCTTCCCATTTTATAGATGAGG + Intergenic
972786114 4:42328117-42328139 TCTATCCCATTGTATAGATAAGG + Intergenic
972992113 4:44833391-44833413 TACTTCCCATTTTACAGATGAGG - Intergenic
973162972 4:47041574-47041596 TGAATCCCATTTGAATGATAGGG + Intronic
973232881 4:47862679-47862701 TGCATCTCATTTTATAAATTTGG - Intronic
973647779 4:52967472-52967494 TTAATCCCATTTTACAGATGAGG + Intronic
973723021 4:53744276-53744298 TTAACCCCATTTTACAGATAGGG - Intronic
974485609 4:62501221-62501243 TTCCTCCTGTTTTAGAGATAAGG - Intergenic
974671644 4:65037502-65037524 TTCATCTCATTTTACAGATTAGG - Intergenic
974963686 4:68734782-68734804 AGAAAACCATTTTAGAGATATGG + Intergenic
975044705 4:69787225-69787247 TGTATAATATTTTAGAGATACGG + Intronic
975083857 4:70312930-70312952 TGCATATAATTTTGGAGATATGG + Intergenic
975493505 4:75013516-75013538 TTTATCCCATTTTACAGATGTGG - Intronic
975713676 4:77185568-77185590 ACCATCCCATTTTACAGATGAGG - Intronic
975734934 4:77371919-77371941 CACATCCCAGTTTACAGATAAGG - Intronic
975818251 4:78242015-78242037 AGCCTCTCATTTTACAGATAAGG - Intronic
975901862 4:79162972-79162994 ATCATCCCATCTTACAGATAGGG + Intergenic
976116897 4:81737703-81737725 TATTTCCCATTTTACAGATAAGG + Intronic
976126428 4:81838003-81838025 TTGTTCCCATTTTACAGATAGGG - Intronic
976203618 4:82603530-82603552 TTATTCCCATTTTACAGATAGGG - Intergenic
976214655 4:82704880-82704902 TGTGTCCCATTTTACAGATGAGG - Intronic
976361786 4:84187780-84187802 TTTCTTCCATTTTAGAGATAAGG + Intergenic
976430970 4:84963836-84963858 TTAATCCCATTTTACAGATGGGG - Intronic
977628389 4:99214385-99214407 TTCATTTCATTTTAGAGACAGGG - Intronic
977665536 4:99643260-99643282 TGTACCCCATTTTACAGATGAGG + Intronic
977705617 4:100067057-100067079 TTATTCCCATTTTACAGATAAGG - Intergenic
977874647 4:102134661-102134683 TTATTCCCATTTTACAGATAGGG - Intergenic
977981427 4:103327625-103327647 TGGAGCCCATTTTATAGATAAGG - Intergenic
978389991 4:108215434-108215456 TTATTCCCATTTTATAGATACGG - Intergenic
980981585 4:139658776-139658798 TTATTCCCATTTTATAGATAAGG - Intergenic
981020421 4:140021937-140021959 TTATCCCCATTTTAGAGATATGG + Intronic
981137964 4:141234960-141234982 TGCCTCACATTTTAGATGTATGG + Intergenic
981700300 4:147600571-147600593 TTGTTCCCATTTTACAGATAAGG + Intergenic
981759760 4:148181389-148181411 GTCCTCCCATTTTACAGATAAGG - Intronic
982152965 4:152483365-152483387 TGTTTCCCTTTTTAGATATATGG + Intronic
982179440 4:152736020-152736042 TGATCTCCATTTTAGAGATAAGG + Intronic
982183460 4:152772450-152772472 TTACTCCCATTTTACAGATAAGG - Intronic
982227835 4:153182079-153182101 AGCAGCCCATTTTACAGATGAGG + Intronic
982931917 4:161419357-161419379 TGCATAGCATTTTAAAAATAAGG + Intronic
983063178 4:163180757-163180779 TTATTCCCATTTTACAGATAAGG + Intergenic
984542495 4:181057451-181057473 CCCATCCCATTTTAATGATATGG - Intergenic
984620516 4:181947044-181947066 TGAAGCCCATTTTATAGATGAGG - Intergenic
984724818 4:183010329-183010351 TGATTCCCATTTTATAGATGAGG - Intergenic
985311351 4:188603484-188603506 TTCATTCTATTTTACAGATAAGG + Intergenic
985336413 4:188900721-188900743 TGTATCCCCTTTTATAGATGAGG - Intergenic
987085858 5:14467020-14467042 GTTATCCCATTTTACAGATAAGG + Intronic
987515523 5:18902212-18902234 TAATTCCTATTTTAGAGATAAGG - Intergenic
988010744 5:25480001-25480023 TGCATGCCATTTTTGAGAACTGG - Intergenic
988010752 5:25480213-25480235 TGCATGCCATTTTTGAGAACTGG - Intergenic
988782113 5:34531873-34531895 TTCTTCACATTTTAGAGATACGG + Intergenic
988802634 5:34710905-34710927 TGCATCCCAAATAAAAGATAAGG - Intronic
988887554 5:35574497-35574519 TCAATCCCATTTTATAGATGAGG + Intergenic
989362950 5:40624282-40624304 TTAATCTCATTTTACAGATAAGG - Intergenic
990092273 5:52066934-52066956 TTCATCCCATTTTACAGAGATGG + Intronic
990181652 5:53167327-53167349 TTCACCCCAATTTAGAGATCTGG - Intergenic
990568704 5:57055965-57055987 TGCAGCTCATTATAGAGATAAGG + Intergenic
990931629 5:61097683-61097705 TTGATCCCATTTTAGAGATTTGG - Intronic
991610534 5:68445428-68445450 TGATTCCCATTTTACAGATGAGG + Intergenic
991614510 5:68482162-68482184 ATCATCCCATTTTATTGATAAGG + Intergenic
992545678 5:77811940-77811962 TGCCTTCCATTTTACAGAAAAGG - Intronic
992879382 5:81091145-81091167 TGCCTCCCATTTCACAGATGGGG - Intronic
994163776 5:96586124-96586146 ATTATCCCATTTTATAGATAAGG + Intronic
994189858 5:96857560-96857582 TCAATCCCATTTTAAAGATAAGG + Intronic
995008841 5:107234706-107234728 AGCTTCCCATTTTACAGATGAGG - Intergenic
995445004 5:112232808-112232830 TACATACCATTTTACAGATGAGG - Intronic
995675196 5:114655258-114655280 TTACTCCCATTTTAGAGATAGGG + Intergenic
996646220 5:125821202-125821224 TTAATGCCATTTTATAGATAAGG - Intergenic
996753849 5:126915951-126915973 TTGTGCCCATTTTAGAGATAAGG - Intronic
997845858 5:137285167-137285189 TGCATCTAATTTTAGTGAGACGG - Intronic
998063991 5:139141647-139141669 TGCATCTGCTTTTAAAGATAGGG - Intronic
998212656 5:140212079-140212101 GATATCCCATTTTAGAGATGAGG + Intronic
998391501 5:141789815-141789837 TCATTCCCATTTTATAGATAAGG + Intergenic
998543983 5:143010355-143010377 TTATTCACATTTTAGAGATATGG - Intronic
999033032 5:148315525-148315547 AGCACCTCATTTTACAGATAAGG - Intronic
999143901 5:149380211-149380233 TTCTTCCCATTCTAGAGATGTGG - Intronic
999259222 5:150227865-150227887 TGATTCCCATATTATAGATAAGG - Intronic
999277779 5:150343227-150343249 TTAATCCCATTTTACAGGTAAGG + Intergenic
999473385 5:151875946-151875968 ACAATCCCATTTTATAGATAAGG - Intronic
999902798 5:156104456-156104478 TGAATCTCACTTTAAAGATAAGG + Intronic
1000173152 5:158723730-158723752 TCCTTCCCAATTTAGAGATGAGG - Intronic
1000189392 5:158894746-158894768 TGAGTCCCATTTTACAGATAAGG - Intronic
1000256362 5:159542257-159542279 AGGATCCCATTTTATAGACATGG - Intergenic
1000776905 5:165430975-165430997 TTGATCCCATTTTACAGATAAGG + Intergenic
1001007017 5:168061218-168061240 TTTTCCCCATTTTAGAGATAAGG + Intronic
1001232592 5:170001566-170001588 TTCTCCCCATTTTAGAGATCAGG - Intronic
1001239721 5:170059022-170059044 TTCTTCCCATTTTACAGATGTGG + Intronic
1001256105 5:170184454-170184476 TGCTTCCCATTTTACAGATAGGG - Intergenic
1001268022 5:170289120-170289142 TGGTCCCCATTTTACAGATAAGG - Intronic
1001284310 5:170411271-170411293 TGATGCCCATTTTACAGATAAGG + Intronic
1001485070 5:172114057-172114079 TGACTCCCATTTTACAGATAAGG + Intronic
1001590553 5:172861549-172861571 TGCTTCCCATTTTACAAATAAGG - Intronic
1001686141 5:173596402-173596424 AGCAGCCCATTTTACAGATGAGG + Intergenic
1001741466 5:174056256-174056278 TTATTCCCATTTTACAGATAAGG - Intronic
1001884968 5:175281315-175281337 TTCCTGCCATTTTACAGATAAGG - Intergenic
1001949823 5:175808564-175808586 GGCATCCCATTTTACAGATGAGG + Intronic
1001969257 5:175940223-175940245 TCATTCCCATTTTACAGATAAGG - Intronic
1001995774 5:176156495-176156517 AGCAGCCCATTTTAGAGTAAAGG - Intergenic
1002062881 5:176636777-176636799 TCATTCCCATTTTACAGATAAGG + Intronic
1002069481 5:176670825-176670847 TGGTACCCATTTTAGAGATGAGG - Intergenic
1002590644 5:180289860-180289882 TGCCTTCCTTTTTAGAGACAGGG + Intronic
1003278377 6:4671746-4671768 TGATTCCCATTTTACAGATGTGG + Intergenic
1003630016 6:7778381-7778403 TTATTCCTATTTTAGAGATAAGG + Intronic
1003745329 6:8994748-8994770 TGCTTCCCATTTTCTGGATAAGG - Intergenic
1004046095 6:12025072-12025094 TGATTCCCATTTTATAGATGTGG + Intronic
1004663013 6:17726941-17726963 TTCCTCCCATTTTACAGATAAGG + Intergenic
1004911767 6:20292614-20292636 TTATTCCCATTTTACAGATAAGG - Intergenic
1005295377 6:24420666-24420688 TGTGTGGCATTTTAGAGATAGGG + Intronic
1006170571 6:32089621-32089643 TTAGTCCCATTTTACAGATAAGG + Intronic
1006590479 6:35151587-35151609 TGCATCCCACTTTGGACTTAGGG + Intergenic
1006800743 6:36758160-36758182 TTATTCCCATTTTAGAGATGAGG - Intronic
1007075186 6:39061731-39061753 TGCTTCCCATTTTACAGATAAGG + Intronic
1007185668 6:39970106-39970128 AGCCTTCCCTTTTAGAGATAGGG + Intergenic
1007248466 6:40479458-40479480 TGCTCCCCATTTTACTGATAAGG - Intronic
1007352677 6:41285378-41285400 TTCTCCCCATTTTATAGATAAGG + Intronic
1007381590 6:41493721-41493743 TTATTCCCATTTTATAGATAGGG + Intergenic
1007408225 6:41646943-41646965 CGAAGCCCATTTTAGAGATGAGG + Intronic
1007722781 6:43895232-43895254 AGCATTCCATTTTATAGATAAGG - Intergenic
1007723444 6:43899990-43900012 TTCATCCCATTTTATAGATGAGG + Intergenic
1007831784 6:44644557-44644579 TTCTTCCCATTTTACAGATGTGG - Intergenic
1007935585 6:45729385-45729407 AGAGTCCCATTTTAGAGATAAGG + Intergenic
1008014600 6:46504186-46504208 TGTATCCCATTAAAGATATATGG - Intergenic
1008025277 6:46628993-46629015 TTAATCCCATTTTACAGATAAGG + Intronic
1008753789 6:54769424-54769446 TGTATCTCATTTTAAAGATGAGG + Intergenic
1010287194 6:74092883-74092905 TTAATCCTGTTTTAGAGATAAGG + Intergenic
1011660586 6:89590826-89590848 TCGAACCCATTTTATAGATAAGG - Intronic
1012567528 6:100677528-100677550 TTATTCCCATTTTACAGATAAGG - Intronic
1013424928 6:110002903-110002925 TGCAACACATTTTAGAACTAAGG + Intergenic
1013838435 6:114360747-114360769 ATCATCCCATTTTACAGAGAAGG - Intergenic
1014288728 6:119533951-119533973 TAAATCCCATTTTATAGATGAGG + Intergenic
1014573792 6:123045038-123045060 TTGTTCCCATTTTACAGATAAGG + Intronic
1015617788 6:135096588-135096610 CTCTTCCCATTTTACAGATAAGG + Intronic
1015902943 6:138086086-138086108 TGATCCCCATTTTAGAGTTAGGG - Intergenic
1016047864 6:139498857-139498879 GTCACCCCATTTTAGAGATAAGG + Intergenic
1017119517 6:151010965-151010987 TTTATACCATTTTACAGATAAGG + Intronic
1017471739 6:154744528-154744550 GTCATCCCATTTTACAGACAAGG + Intronic
1017785026 6:157749357-157749379 CTCATCCCATTTTATAGATGAGG - Intronic
1018217685 6:161546267-161546289 TATACCCTATTTTAGAGATAAGG + Intronic
1018513056 6:164547113-164547135 TGCATCTTATTTTAGTGGTAAGG + Intergenic
1019700170 7:2470982-2471004 TGCACCCCATTTTATGGATGGGG + Intergenic
1020548461 7:9566118-9566140 TGAATCCCCTTGAAGAGATAGGG - Intergenic
1020926398 7:14332244-14332266 TTGTGCCCATTTTAGAGATAAGG + Intronic
1022040445 7:26576407-26576429 TCCAAGCCATTTTAAAGATAAGG + Intergenic
1022835155 7:34106375-34106397 TTCATCTCATTTTACAGACAAGG - Intronic
1022871447 7:34484248-34484270 TCTTTCCCATTTTATAGATATGG + Intergenic
1023064492 7:36363742-36363764 ATTATCCCATTTTACAGATAAGG - Intronic
1023128337 7:36977051-36977073 TTTATCCCCTTTTATAGATAAGG - Intronic
1023138863 7:37081264-37081286 AGTATTCCATTTTATAGATAGGG - Intronic
1023904761 7:44514096-44514118 TCCTTCCCATTTTACAGATGAGG - Intronic
1025115194 7:56251963-56251985 GTTATCCCATTTTAGAGATGAGG + Intergenic
1025603505 7:63022532-63022554 TTCACCCAATTTTAGAGATAGGG - Intergenic
1026587889 7:71671641-71671663 TTCCTCCCATTTTATAGATGAGG - Intronic
1026892626 7:73991365-73991387 TGCTTCCCATTTTTCAGATGTGG + Intergenic
1027291260 7:76713511-76713533 TGCATCTAATTTTGTAGATAAGG + Intergenic
1027370380 7:77503427-77503449 TCAGTCCCATTTTATAGATATGG - Intergenic
1028741811 7:94283962-94283984 TGTATCACATTTGAGAGTTAGGG + Intergenic
1028931832 7:96421658-96421680 TAAACCCCATTTTACAGATAAGG - Intergenic
1029691529 7:102185342-102185364 TGATCCCCATTTTATAGATAAGG + Intronic
1030207196 7:106962372-106962394 TTATTCCCATTTTACAGATAAGG + Intergenic
1030686937 7:112496696-112496718 TGCTTCCCCACTTAGAGATAAGG - Intergenic
1030840625 7:114349352-114349374 ATCATTCCATTTTAGAGATGAGG + Intronic
1031152284 7:118068078-118068100 TGGATCCCATTTTATAGATGAGG - Intergenic
1031248224 7:119345530-119345552 TGCATCACATTTTATTGATATGG + Intergenic
1031842419 7:126760105-126760127 TGCATCCCAGTTTAGACCCAAGG + Intronic
1031949000 7:127872192-127872214 AGCATCTCATTTTATAGGTATGG + Intronic
1032584961 7:133137872-133137894 CCAATTCCATTTTAGAGATAAGG - Intergenic
1032640949 7:133767315-133767337 AGCACCCCATTTTATAAATAAGG - Intronic
1032984239 7:137319221-137319243 TTAATCCCATTTTACAGATGAGG - Intronic
1033249225 7:139744661-139744683 ATCATCCCATTTTACAGATGAGG + Intronic
1033284288 7:140027081-140027103 CACATCCCATTGTAGAGATGAGG - Intronic
1033524569 7:142197478-142197500 TGCATCAGAGTATAGAGATAAGG - Intronic
1034387022 7:150748466-150748488 AGCATCACATTTTACAGATGAGG + Intronic
1034909573 7:154984077-154984099 TCCACCCCATTTTAAACATAAGG + Intronic
1035031309 7:155862951-155862973 GGAATCCCATTTTACAGATGTGG - Intergenic
1035211506 7:157332142-157332164 TTCTTCCTATTTTACAGATAGGG + Intergenic
1035384918 7:158464948-158464970 TTATCCCCATTTTAGAGATAAGG + Intronic
1035425866 7:158772674-158772696 TGCATCCCTGCTTAGAGACAAGG - Intronic
1035550559 8:520836-520858 TTCACCCCTTATTAGAGATATGG + Intronic
1036177907 8:6556758-6556780 TGCGTGCCATTGTAGAGATGGGG + Intronic
1036414642 8:8535686-8535708 TTATTCCCATTTTAGAGATGAGG + Intergenic
1036781706 8:11652175-11652197 TTCACCCAATTTTAGAGATAAGG + Intergenic
1037524707 8:19713480-19713502 TGCATCCTTTTTTGGAAATAAGG + Intronic
1038230017 8:25691097-25691119 ATCATCCCATTTTACAGATGAGG + Intergenic
1038238298 8:25783823-25783845 TGATTCCCATTTTACAGATGAGG + Intergenic
1038449619 8:27631654-27631676 TGCTGCCCATTTTACAGATGAGG - Intergenic
1040495735 8:47963874-47963896 TGGTTCCCATTTTACAGATGAGG - Intronic
1040554223 8:48464954-48464976 GCCATCCCATTTCTGAGATAAGG - Intergenic
1040747435 8:50662476-50662498 TTATTCCCATTTTAGAGATTTGG + Intronic
1040889151 8:52297280-52297302 AGCACCCCGTTTTAGAGATGAGG - Intronic
1041264352 8:56049144-56049166 TCCATTCCATTTGAGAGCTAGGG + Intergenic
1041550184 8:59091579-59091601 TGAAACCCATTTTACAGATGAGG - Intronic
1041944571 8:63426925-63426947 GGCAACCCAATTTGGAGATATGG - Intergenic
1042777596 8:72450946-72450968 TGCACCCCATTTTGAACATAAGG + Intergenic
1043076391 8:75706765-75706787 TGAATCCCGTTTTAGGGACATGG - Intergenic
1043155368 8:76772070-76772092 TACCTTCCATTTTAGGGATAAGG - Intronic
1043801314 8:84614057-84614079 TGGATCCCATTTTACAGATGAGG - Intronic
1044388656 8:91622216-91622238 AGAACCACATTTTAGAGATATGG - Intergenic
1044409167 8:91866244-91866266 TGGATCTCAATTTACAGATAAGG - Intergenic
1044726455 8:95198224-95198246 TTCCTCCCATTTTATAGACAAGG - Intergenic
1044926832 8:97216500-97216522 AGCATCCCATTTTACAGATGAGG + Intergenic
1044929221 8:97235681-97235703 TGATTCCCATTTTATAGATGAGG + Intergenic
1044978114 8:97686396-97686418 TTAGTCCCATTTTAGAGATGAGG - Intronic
1045107060 8:98902844-98902866 ACCATCCTATTTTACAGATAAGG + Intronic
1045296459 8:100875683-100875705 CTCATCCCATTTTATAGATGAGG + Intergenic
1045678200 8:104631549-104631571 TAATTCCCATTTTATAGATAAGG + Intronic
1045748143 8:105448706-105448728 TTATTCCCATTTTAAAGATAAGG - Intronic
1046205067 8:110983383-110983405 TGCAGCTCATTTTAGCCATATGG + Intergenic
1046258334 8:111730913-111730935 AACATCCCATTTTAGAGAAATGG + Intergenic
1046716114 8:117569281-117569303 TTACTCCCATTTTACAGATAAGG - Intergenic
1046834726 8:118787785-118787807 TTATTCCCATTTTACAGATAAGG + Intergenic
1046853567 8:119003738-119003760 TTATTCCAATTTTAGAGATAAGG - Intronic
1046947717 8:119989574-119989596 TGATTCCCAGTTTACAGATAAGG - Intronic
1047537582 8:125733759-125733781 AGCATCCCATTTTACAGATGTGG - Intergenic
1047765547 8:127987055-127987077 TTCTTCCCATTTTACAGATGTGG - Intergenic
1047831312 8:128633594-128633616 TAACTCTCATTTTAGAGATAGGG + Intergenic
1048020751 8:130536935-130536957 TGGAACCCATTTTATAGATGAGG - Intergenic
1048335356 8:133498385-133498407 ATCATCCCATTTTCCAGATAAGG - Intronic
1048343769 8:133560855-133560877 TTAATCCCATTTTATAGATGTGG - Intronic
1048367132 8:133747945-133747967 ATTATCCCATTTTACAGATAAGG + Intergenic
1048389865 8:133952456-133952478 TTCTTCCCATTTTACAAATAAGG - Intergenic
1048637114 8:136309162-136309184 ACCATCCCAATTTAGAGATGTGG + Intergenic
1048818396 8:138355761-138355783 TGCATAGCATTTAAGAAATAGGG + Intronic
1050014880 9:1223102-1223124 GTCATCCCATTTTAAAGATGAGG - Intergenic
1050115376 9:2258067-2258089 TCTGTCCCATTTTATAGATAGGG - Intergenic
1050431331 9:5565023-5565045 TGCTTCCCATTTTATAGGTGAGG + Intronic
1050662476 9:7898110-7898132 TTACTCCCATTTTACAGATATGG - Intergenic
1051103232 9:13547119-13547141 TGATTCCCATTTTATAGATGAGG - Intergenic
1051437323 9:17046793-17046815 AGCATTCCATTTTATGGATATGG - Intergenic
1051614223 9:18992083-18992105 AACATCCCATTCTATAGATAAGG + Intronic
1053291857 9:36885414-36885436 TCCTCCCCATTTTATAGATAAGG - Intronic
1053304858 9:36977233-36977255 TTCCTCCCATTTTACAGATGAGG + Intronic
1053352301 9:37421776-37421798 TGCAACTCATTTTATAGACAAGG - Intergenic
1054829514 9:69607862-69607884 TATCTCCCATTTTATAGATAAGG - Intronic
1055465533 9:76561801-76561823 TCCCTCCCATTTTACAGATGAGG + Intergenic
1055488312 9:76778647-76778669 TGTATCCCATTTTATGGATGGGG - Intronic
1055902797 9:81260559-81260581 TTATCCCCATTTTAGAGATAGGG + Intergenic
1055917025 9:81414475-81414497 AGCATCCAATTTTAGTGAAAGGG - Intergenic
1056133036 9:83604061-83604083 TGCATCCCTTTGTAGAGGGATGG + Intergenic
1056213102 9:84383387-84383409 TCCCTCCCATCTTACAGATAAGG - Intergenic
1056724618 9:89103758-89103780 TGAATCCCATTTTAAACATGGGG + Intronic
1057010516 9:91597354-91597376 AGCATCCCATTTCACAGATGAGG - Intronic
1057408464 9:94795097-94795119 TTATTCCCATTTTATAGATAAGG + Intronic
1057847854 9:98539208-98539230 TGGTTCCCATTTTACAGATGGGG - Intronic
1057896816 9:98915776-98915798 CTCTTCCCATTTTACAGATAAGG - Intergenic
1057913632 9:99039177-99039199 ATAATCCCATTTTAGAGATCTGG - Intronic
1058118788 9:101115715-101115737 TGCATCCCATTTTAATGAAAGGG + Intronic
1058118794 9:101115792-101115814 TGCATCCCATTTTAATGAAAGGG + Intronic
1058498295 9:105584123-105584145 TGCCTCCCATTTTGTAGATAAGG - Intronic
1058726672 9:107811265-107811287 TTATTCCCATTTTACAGATATGG + Intergenic
1058737763 9:107909764-107909786 TTCATCCCCTTTTATAGCTAGGG - Intergenic
1058877242 9:109255021-109255043 TTAACCCCATTTTACAGATAAGG - Intronic
1059461416 9:114433012-114433034 TTAATCCCATTTTACAGATGAGG + Intronic
1059819186 9:117952802-117952824 TGCATCAGTTTTTAGACATACGG + Intergenic
1060027075 9:120182374-120182396 TGATTCACATTTTAGAGATGAGG - Intergenic
1060149117 9:121276339-121276361 TGTAGCCCATTTTACAGATGAGG - Intronic
1060297363 9:122351846-122351868 TCAATCCCATTTTGGAGATTGGG - Intergenic
1060437783 9:123609766-123609788 AGGATTCCATTTTAAAGATAAGG - Intronic
1060665265 9:125428797-125428819 ATCATCCCATTTTACAGATGAGG - Intergenic
1060745536 9:126128518-126128540 ATTATCCCATTTTACAGATAGGG - Intergenic
1060821397 9:126663580-126663602 TTTATCTCATTTTAGAGACAAGG - Intronic
1060826285 9:126689851-126689873 TTAACCCCATTTTAGAGATGAGG - Intronic
1060850299 9:126869353-126869375 TGACTCCCATTTTAAAGATGAGG - Intronic
1061000194 9:127898646-127898668 TGTTGCCCATTTTACAGATAAGG + Intronic
1061070953 9:128310332-128310354 TAACTCCCATTTTACAGATAGGG - Intronic
1061238434 9:129355377-129355399 TTCTTCCCATTTTACAGATTAGG + Intergenic
1061238764 9:129357316-129357338 GGCATCCCATTTTACAGATGAGG - Intergenic
1061446726 9:130642916-130642938 TGCTCCCCATTTTACAGATGAGG + Intergenic
1061518157 9:131101646-131101668 TGACTTCCATTTTAGAGATGAGG + Intronic
1062163539 9:135093415-135093437 TGAGTCCCATTTTACACATAGGG - Intronic
1062198261 9:135286727-135286749 TGCTCCCCATTTTATAGACAGGG + Intergenic
1062382678 9:136294986-136295008 GGCACCCCATTTTACAGATGGGG - Intronic
1185677711 X:1862063-1862085 TTCATTTCTTTTTAGAGATACGG + Intergenic
1185678463 X:1868147-1868169 TTCATTTCTTTTTAGAGATACGG + Intergenic
1186480083 X:9890059-9890081 AGGAACACATTTTAGAGATAAGG + Intronic
1186501737 X:10056225-10056247 TGCATCAAATTTAAGATATAGGG + Intronic
1186617150 X:11201412-11201434 TTCTTTCCATTTTACAGATAAGG + Intronic
1186996603 X:15130603-15130625 TTATTCCCATTTTACAGATAAGG + Intergenic
1187164689 X:16794063-16794085 TACATCCCAGTTTACAGATAAGG + Intronic
1187411772 X:19056959-19056981 TCACTCCCATTTTACAGATAAGG - Intronic
1187450651 X:19393248-19393270 TTCATCCCCTTTTATAGATGGGG - Intronic
1187569325 X:20485067-20485089 TCATTCCCATTTTACAGATAAGG + Intergenic
1187734192 X:22288198-22288220 TCAACTCCATTTTAGAGATAAGG + Intergenic
1188002814 X:24998074-24998096 TGCCTCACATTCTAGAGAAATGG - Intergenic
1188047054 X:25438008-25438030 TTCTTCCCATTTTAGAGAAGAGG + Intergenic
1188540143 X:31240804-31240826 TCAATCCCATTTTATAAATAAGG + Intronic
1188679529 X:32984574-32984596 TACTTCCCTTTTTATAGATAGGG - Intronic
1188720367 X:33516060-33516082 TCTATCCCATTTTACAGATAAGG + Intergenic
1189115211 X:38335137-38335159 TGCACCCCAGTTTAGAGAATAGG + Intronic
1189129499 X:38483738-38483760 TGCAGTTCATTTTAGAGAAAAGG - Intronic
1190257233 X:48772772-48772794 TCCTTCCCATTTTACAGATGAGG + Intronic
1190842664 X:54160355-54160377 TACACCCCATTTTAGAAATGGGG + Intronic
1191940488 X:66475216-66475238 TACATTCCATTTTACAGATGAGG + Intergenic
1192145936 X:68682605-68682627 ATTATCCCATTTTACAGATAAGG - Intronic
1192189961 X:68984983-68985005 TCCCCCCCATTTTACAGATAGGG + Intergenic
1192597841 X:72430150-72430172 TTCCTCTCATTTTAGAGAAAGGG + Intronic
1194280435 X:91946173-91946195 TGATTCCCATTTTACAGATAAGG + Intronic
1194654098 X:96550088-96550110 ATCATCCCATTTTACAGATGAGG - Intergenic
1194666697 X:96684506-96684528 GGTAGCCCATTTTAGAGATGGGG - Intergenic
1195086334 X:101417884-101417906 GTCATCCCACTTTAGAGATGAGG + Intergenic
1195342866 X:103921821-103921843 TGTATCCCATTTTGCAGAGAGGG + Intronic
1195363925 X:104109745-104109767 TGTATCCCATTTTGCAGAAAGGG - Intronic
1195397942 X:104431169-104431191 TTCTCCCCATTTTACAGATAAGG - Intergenic
1195545767 X:106110760-106110782 TGTTTCTCATTTTATAGATATGG + Intergenic
1195664476 X:107416440-107416462 TTCATCCCATTATTGAGAGAGGG + Intergenic
1195667231 X:107442428-107442450 TAATTCCCATTTTATAGATAAGG - Intergenic
1195770207 X:108342650-108342672 TGCATCCCTATTTAGAAACAAGG + Intronic
1195824300 X:108981137-108981159 TTCTGCCCATTTTACAGATATGG - Intergenic
1195891076 X:109695749-109695771 TTAAACCCATTTTAAAGATAAGG + Intronic
1196123630 X:112077103-112077125 TTAATCCCATTTTATAGATGGGG + Intronic
1196503005 X:116407676-116407698 TTCATCTCATTTTCTAGATAAGG - Intergenic
1196535848 X:116843128-116843150 TATTTCCCACTTTAGAGATAAGG - Intergenic
1196856851 X:119992213-119992235 TGTATCTAATTTTAGAGACAGGG - Intergenic
1196859456 X:120014034-120014056 TGTATCTAATTTTAGAGATAGGG + Intergenic
1197283039 X:124560431-124560453 TCAACCCCATTTTAGAAATAAGG + Intronic
1197696658 X:129557193-129557215 TGCTTCCTATATTAGAGATCTGG + Intronic
1197721735 X:129749897-129749919 CCCATCCCATTTTACAGATAAGG - Intronic
1197760934 X:130027744-130027766 TTCTCCCCATTTTACAGATATGG + Intronic
1197782967 X:130175117-130175139 TCATTCCCATTTTATAGATAAGG + Intronic
1197861768 X:130978670-130978692 TTTTTCCCACTTTAGAGATAAGG + Intergenic
1198119184 X:133575165-133575187 TAACTCCCATTTTATAGATAAGG - Intronic
1198776825 X:140188531-140188553 AGCAATCCATTTTACAGATAAGG + Intergenic
1198941266 X:141958828-141958850 TCCCTCACATTTTATAGATAAGG - Intergenic
1198998047 X:142598752-142598774 TTAAACCCATTTTACAGATATGG - Intergenic
1199066830 X:143429196-143429218 TGGACCACATTTTACAGATAAGG - Intergenic
1199175425 X:144782953-144782975 TTCATCTCATTTTACAGAGAAGG + Intergenic
1199319046 X:146416894-146416916 TTAATCCCATTTTACAGCTAAGG + Intergenic
1199734335 X:150670380-150670402 TGATTCCCATTTTACAGATAGGG + Intronic
1199883446 X:151995313-151995335 AGCATCCCATTTTACAGATGAGG + Intergenic
1200597911 Y:5169701-5169723 TGATTCCCATTTTACAGATAAGG + Intronic