ID: 971460367

View in Genome Browser
Species Human (GRCh38)
Location 4:26889615-26889637
Sequence CCAATAATGAGTCCCTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 10, 3: 46, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971460367_971460373 22 Left 971460367 4:26889615-26889637 CCATATCAGGGACTCATTATTGG 0: 1
1: 1
2: 10
3: 46
4: 226
Right 971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 95
971460367_971460371 -1 Left 971460367 4:26889615-26889637 CCATATCAGGGACTCATTATTGG 0: 1
1: 1
2: 10
3: 46
4: 226
Right 971460371 4:26889637-26889659 GTTTCTGTAACTGGCAGATTGGG 0: 1
1: 0
2: 1
3: 25
4: 249
971460367_971460369 -10 Left 971460367 4:26889615-26889637 CCATATCAGGGACTCATTATTGG 0: 1
1: 1
2: 10
3: 46
4: 226
Right 971460369 4:26889628-26889650 TCATTATTGGTTTCTGTAACTGG 0: 1
1: 0
2: 2
3: 25
4: 246
971460367_971460370 -2 Left 971460367 4:26889615-26889637 CCATATCAGGGACTCATTATTGG 0: 1
1: 1
2: 10
3: 46
4: 226
Right 971460370 4:26889636-26889658 GGTTTCTGTAACTGGCAGATTGG 0: 1
1: 0
2: 2
3: 29
4: 271
971460367_971460374 26 Left 971460367 4:26889615-26889637 CCATATCAGGGACTCATTATTGG 0: 1
1: 1
2: 10
3: 46
4: 226
Right 971460374 4:26889664-26889686 ATTAGCACCTGTAGCCAGGTCGG 0: 1
1: 0
2: 1
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971460367 Original CRISPR CCAATAATGAGTCCCTGATA TGG (reversed) Intronic
901969547 1:12896309-12896331 TCAATAATGAGTCCCGGAAGAGG - Intronic
904179306 1:28654682-28654704 CCAACACTGAGCCCTTGATATGG - Intergenic
904964605 1:34361731-34361753 ACAAACATGAGTCCCTGCTATGG - Intergenic
905465367 1:38149078-38149100 CCAACACTGAGCCCTTGATATGG + Intergenic
905840329 1:41171153-41171175 TCAACATTGAGCCCCTGATATGG + Intronic
905951933 1:41959190-41959212 CCAATTCTGAGACCCTGAGATGG + Intronic
906050624 1:42868384-42868406 CCAACACTGAGCCCTTGATATGG + Intergenic
906825609 1:48976364-48976386 CCAATACTGATTCTCTGATATGG + Intronic
906996014 1:50795196-50795218 CTAATATTGAGTCCCCAATAAGG + Intronic
908052451 1:60247686-60247708 TCAATACTGAGCCCTTGATATGG + Intergenic
908737525 1:67291788-67291810 CCAACACTGAGCCCTTGATATGG + Intergenic
909278852 1:73723076-73723098 CCAATACTGAGTCTCTGATATGG + Intergenic
910141668 1:84033000-84033022 CCAACACTGAGTCACTGATATGG + Intergenic
910491670 1:87779388-87779410 CAAATGATGAGTCACTGAGAGGG + Intergenic
910588352 1:88902695-88902717 CCAACACTGAGCCCTTGATATGG + Intergenic
910948348 1:92617683-92617705 CCAACACTGAGCCCTTGATATGG + Intronic
911688916 1:100809024-100809046 CGAATAAAAAGTCCCTGAGATGG + Intergenic
911883705 1:103271437-103271459 CCAACACTGAGCCCTTGATATGG + Intergenic
912733190 1:112127858-112127880 CCAACACTGAGCCCTTGATATGG - Intergenic
916285464 1:163100494-163100516 CCAACACTGAGCCCTTGATATGG + Intergenic
916642564 1:166746133-166746155 CTAATAATGATTCCCTCATATGG - Intergenic
917256541 1:173122250-173122272 ACAATAATAACTCCCTCATAGGG + Intergenic
918038289 1:180896493-180896515 CCAACACTGAGTCCCCAATATGG + Intergenic
919241900 1:194925180-194925202 CCAACACTGAGCCCTTGATATGG + Intergenic
920197570 1:204239331-204239353 CCAACATTGAGCCCTTGATATGG + Intronic
920591048 1:207219190-207219212 CCAACAATGGGTCACTGAAAGGG - Intergenic
921287682 1:213623653-213623675 CTAATAATGAGTTCCTAATAAGG - Intergenic
922780915 1:228251627-228251649 CCAACAATGAGCCCTCGATATGG - Intronic
923025127 1:230197826-230197848 CCAATGCTGTGTCACTGATAAGG - Intronic
924318715 1:242825489-242825511 CCAAGAATGAGTTGCTGAAAGGG - Intergenic
924829628 1:247579325-247579347 CAAACATTGAGCCCCTGATATGG + Intergenic
924847006 1:247784169-247784191 CCAACACTGAGCCCTTGATATGG - Intergenic
1065607140 10:27429461-27429483 CCAACACTGAGTCCCTGATATGG + Intergenic
1067125417 10:43511571-43511593 CCAACACTGAGCCCTTGATATGG - Intergenic
1067262977 10:44710621-44710643 CCAATAACGAGTGCGTGATCCGG + Intergenic
1067421767 10:46158402-46158424 ACAATATTGAGCCCCTGATATGG - Intergenic
1067507073 10:46864491-46864513 ACAATATTGAGCCCCTGATATGG - Intergenic
1068154797 10:53185158-53185180 TCAATTCTGAGTCCTTGATATGG - Intergenic
1068393186 10:56425552-56425574 ACAACATTGAGACCCTGATATGG + Intergenic
1068854558 10:61784280-61784302 ACAATAATGTCTCCCTGATGTGG + Intergenic
1068856777 10:61805930-61805952 CCAACAGCGAGTCCCTGATATGG + Intergenic
1069145889 10:64891401-64891423 CCAACACTGAGTCCTGGATATGG + Intergenic
1070098316 10:73360172-73360194 CCAATATTGATTTCCTGATGTGG + Intergenic
1070859246 10:79637544-79637566 ACAACATTGAGCCCCTGATATGG - Intergenic
1071686170 10:87760169-87760191 CAAATGATGAGACCCTGATATGG + Intronic
1072209130 10:93230732-93230754 CCAACAATGAGCCCTCGATATGG - Intergenic
1072360594 10:94655061-94655083 CCAACACTGAGCCCTTGATATGG + Intergenic
1073598636 10:104824532-104824554 CCAATCATGAGTTGGTGATAGGG + Intronic
1074340255 10:112621476-112621498 ACAATAATGTGTACCTGATAAGG - Intronic
1074632393 10:115273095-115273117 CCAACACTGAGCTCCTGATATGG - Intronic
1076010620 10:126985338-126985360 CCAATAATGCCTGCCTCATAGGG - Intronic
1076271453 10:129155798-129155820 CCAACACTGAGCCCCTGGTATGG + Intergenic
1076772483 10:132673863-132673885 CCAACACTGAGTCCTTGATATGG - Intronic
1078182159 11:9020922-9020944 ACTCTAATGAGTCACTGATACGG + Exonic
1078268023 11:9769538-9769560 CCAATGCTGAGCCCCTGAAATGG + Intergenic
1082929919 11:58591877-58591899 CCAACACCGAGTCCCTGATATGG - Intronic
1085576893 11:77613593-77613615 CAAAAGATGAGTCCCAGATATGG + Intronic
1085616093 11:78000057-78000079 CCAACACTAAGCCCCTGATATGG - Intergenic
1087262766 11:96029294-96029316 GCAATAATGTTCCCCTGATAGGG + Intronic
1087618545 11:100517045-100517067 CCAACATTGAGGCCCTGATATGG + Intergenic
1090753883 11:129771673-129771695 GCAACACTGAGTCCCTGATATGG - Intergenic
1092272531 12:7034642-7034664 CCAACACAGAGTCCCTGATATGG + Intronic
1092381682 12:8001874-8001896 CCAACACTGAGCCCTTGATATGG + Intergenic
1093031729 12:14294984-14295006 CCAACACTGAGCCCTTGATATGG - Intergenic
1093981473 12:25479847-25479869 CCAACATTGAGCCCTTGATATGG - Intronic
1094389657 12:29935272-29935294 CCAACACTGAGTCCCCGATATGG - Intergenic
1095121378 12:38423888-38423910 CCAACACTGAGCCCTTGATATGG - Intergenic
1095603986 12:44045286-44045308 CCAACACTGAGCCCTTGATATGG + Intronic
1095856119 12:46862725-46862747 CCAACACTGAGCCCTTGATATGG - Intergenic
1097564514 12:61251498-61251520 CCAACACTGAGCCCTTGATATGG - Intergenic
1098673152 12:73255195-73255217 CCAACACTGAGCCCTTGATATGG + Intergenic
1098749969 12:74280547-74280569 CCAACACTGAGTCCTTGATATGG + Intergenic
1098957778 12:76705276-76705298 CCAAAATTGAGTCCCTGATCTGG - Intergenic
1099438233 12:82668922-82668944 CCAAACATTGGTCCCTGATATGG + Intergenic
1099490542 12:83283301-83283323 CCAACACTGAGCCCCTGATATGG - Intergenic
1100424937 12:94475451-94475473 CCAACCCTGAGTCCCTGATATGG - Intergenic
1100544750 12:95590940-95590962 CCAACAATGAGTCCCTGATATGG + Intergenic
1103239904 12:119404451-119404473 CCATCAATGAGACCCTGAGAGGG + Intronic
1103396667 12:120612398-120612420 CCAATACTGAGCCCTCGATATGG + Intergenic
1103409789 12:120702818-120702840 CCATTACTGAGTCCTTGAAATGG + Intergenic
1105384138 13:19914487-19914509 CCAACACTGAGTCCCTGATATGG + Intergenic
1105740249 13:23316132-23316154 CCAACACTGAGCCCTTGATATGG + Intronic
1108404709 13:50088679-50088701 CCAATAATGATTCCTGGAAAGGG + Intronic
1111317634 13:86582750-86582772 CCAACACTGAGCCCTTGATATGG + Intergenic
1111536169 13:89605661-89605683 CCAATACTGAGCCCTTGATATGG - Intergenic
1113339272 13:109405931-109405953 CCAAAGAAGAGTCCCTGATTAGG + Intergenic
1114004903 14:18301779-18301801 TCAATAATGAGACTCTTATATGG - Intergenic
1114896236 14:26994392-26994414 CCAACACTGAGTCTATGATATGG - Intergenic
1116059031 14:39897877-39897899 TCAACACTGAGTCCTTGATATGG + Intergenic
1116068225 14:40010119-40010141 TCAATACTGAGTCCTCGATATGG + Intergenic
1117216984 14:53561125-53561147 CCAACACTGAGCCCTTGATATGG + Intergenic
1117907853 14:60609258-60609280 CCAGTAATGATTCCTTGAGAAGG + Intergenic
1119059570 14:71461245-71461267 CCAACACTGAGTCCTTGATATGG - Intronic
1120919825 14:89744666-89744688 CCAACACTGAATCCCTGCTATGG + Intergenic
1123389363 15:19854013-19854035 TCAATAATGAGACTCTTATATGG - Intergenic
1123772857 15:23546526-23546548 CCAACACTTAGTCCCTGATATGG - Intergenic
1123826115 15:24083879-24083901 CCAACATTGAGTCCCTGATAAGG - Intergenic
1124571313 15:30866750-30866772 CCAACACTGAGTCCTTAATATGG - Intergenic
1124571808 15:30871265-30871287 CCAACACTGAGTCCCTGATATGG + Intergenic
1130131984 15:81151359-81151381 CCAACACTGAGCCCTTGATATGG - Intergenic
1130377050 15:83338515-83338537 CCAACACTGACTCCTTGATATGG + Intergenic
1130817866 15:87459270-87459292 CCGATTATGAGTCCTTGAAAAGG - Intergenic
1131895754 15:97027568-97027590 CCAATACTGCATTCCTGATATGG - Intergenic
1135626134 16:23996449-23996471 CCAACACTGAGTTCCTGATATGG + Intronic
1136078023 16:27830254-27830276 GCAAAACTGAGTCCCTGATTTGG - Intronic
1140109546 16:71991516-71991538 GGAAAAATTAGTCCCTGATATGG + Intronic
1140253195 16:73312950-73312972 CCAAAAATGGGTCAGTGATATGG + Intergenic
1140874165 16:79134921-79134943 CCAATAATGAGTTCCAAACAGGG + Intronic
1142335990 16:89490045-89490067 CCAATAATGGGTCCCGGAGCGGG - Intronic
1146685354 17:34837729-34837751 CAGATAAGGAGTCCCTGATCTGG - Intergenic
1148963224 17:51410901-51410923 TCAATAATGCCTACCTGATAAGG + Intergenic
1153486059 18:5599428-5599450 CCAGTATTTAGTCCCTGATATGG + Intronic
1154532520 18:15362100-15362122 TCAATAATGAGACTCTTATATGG + Intergenic
1155726010 18:29084230-29084252 CCAATTATGCCTCCCTGGTAAGG + Intergenic
1156998705 18:43498676-43498698 CCAACAATGAGCCCTTGATATGG + Intergenic
1157341340 18:46780959-46780981 CCAACACTGAGCCCTTGATATGG + Intergenic
1157870807 18:51228648-51228670 CCAATACTGAGCCCTCGATATGG - Intergenic
1158882612 18:61795539-61795561 CCTATAACCAGTCCCTGAAATGG - Intergenic
1159272370 18:66169047-66169069 CCAGCACTGAGTCCCTGATATGG - Intergenic
1161485637 19:4534273-4534295 CCAATAATGAGCCTCTGGCAAGG + Intronic
1162777272 19:12987546-12987568 CCCAAATTGAGTCCCTAATAGGG + Intergenic
926810262 2:16749730-16749752 CCAATATTGAGTCCTGGATATGG - Intergenic
931658688 2:64535905-64535927 AAAATAATGAGGCCCTGACAAGG + Intronic
932870563 2:75394137-75394159 CCAACACTGAGCCCTTGATATGG - Intergenic
933394337 2:81712410-81712432 CCAACACTGAGCCCTTGATATGG - Intergenic
934893545 2:98091338-98091360 TTAATAATGAGTAACTGATATGG + Intronic
935184079 2:100715845-100715867 CCAACACTGAGCCCTTGATATGG + Intergenic
937180273 2:119989478-119989500 GCAATAATGATTACCTGAAAAGG + Intergenic
938531620 2:132193320-132193342 TCAATAATGAGACTCTTATATGG + Intronic
940171175 2:150831762-150831784 CCAACACTGAGACCTTGATATGG - Intergenic
940797680 2:158097990-158098012 GCAATTATGAGTCCCTAATAAGG + Intronic
943053726 2:182948887-182948909 CCAAGAATGAGTTTCAGATAAGG - Intronic
943317793 2:186411378-186411400 TCAACAATGAGCCCTTGATATGG - Intergenic
943799998 2:192045725-192045747 CCAACACCGAGTCCCTAATATGG + Intronic
943819032 2:192295042-192295064 CCAATAATGAGTTCATTAGATGG + Intergenic
943833483 2:192490209-192490231 CCAACACTGAGCCCTTGATATGG - Intergenic
944673724 2:202017463-202017485 CCAACTATAAGTCCCTGTTACGG - Intergenic
944879957 2:204002632-204002654 CCAATAATGTGTCCTTGAATTGG - Intergenic
945691912 2:213046984-213047006 CCAGTGCTGAGACCCTGATATGG + Intronic
947293233 2:228600707-228600729 CCAATATTGAGACCCTAAAAAGG - Intergenic
1169610976 20:7379786-7379808 CCAACAATGAGCCCCCAATATGG - Intergenic
1171315989 20:24195164-24195186 CCAACACTGAGCCCCTAATAAGG + Intergenic
1173957968 20:47049364-47049386 CCAGTCAAGGGTCCCTGATATGG + Intronic
1175069914 20:56324557-56324579 CCTATAAAGAGTCCCTGGGAGGG + Intergenic
1176764840 21:13006110-13006132 TCAATAATGAGACTCTTATATGG - Intergenic
1177913310 21:27057157-27057179 CCAACACTGAGCCCTTGATATGG + Intergenic
1180429417 22:15232569-15232591 TCAATAATGAGACTCTTATATGG - Intergenic
1180512026 22:16100903-16100925 TCAATAATGAGACTCTTATATGG - Intergenic
1181373581 22:22438215-22438237 CCAACACTGAGCCCTTGATATGG - Intergenic
949125533 3:442164-442186 CCAATACTGAGCCCTCGATATGG - Intergenic
949246007 3:1925872-1925894 CCAACACTGAGCCCTTGATATGG + Intergenic
949445746 3:4132006-4132028 CCAACACTGAGCCCTTGATATGG + Intronic
949639039 3:6014463-6014485 CCAACACTGAGCCCTTGATATGG + Intergenic
951772450 3:26273739-26273761 CCAAGAATGTGTCCCTGAGTGGG + Intergenic
952587609 3:34911701-34911723 CCAACAATGAGTCACTAATAGGG - Intergenic
953790415 3:45943106-45943128 CCAATGCTGAGTCCATGGTATGG - Intronic
953805012 3:46061263-46061285 TCAACACTGAGTCTCTGATAGGG - Intergenic
955708012 3:61748550-61748572 CCAATAATGGGGCCCTTTTATGG - Intronic
955801795 3:62694448-62694470 CCAACACTGAGTCCTTAATATGG + Intronic
956526982 3:70175706-70175728 TAAATAATGAATTCCTGATAAGG + Intergenic
958094125 3:88919509-88919531 GCAATAATGGATACCTGATATGG - Intergenic
958780962 3:98541995-98542017 ACAATGATGAGTGCTTGATATGG - Intronic
960125953 3:113998637-113998659 CTAACAATGAGTCCCTGATGTGG + Intronic
960383859 3:116995889-116995911 CCAATGCTGAGTTTCTGATATGG + Intronic
962214800 3:133512025-133512047 CCAACACTGAGCCTCTGATATGG + Intergenic
963021893 3:140879735-140879757 CCAATGCTGAGTGCTTGATATGG + Intergenic
963060640 3:141222090-141222112 ACAATATTGAGTCAGTGATAGGG - Intergenic
963879103 3:150507525-150507547 CCAATGGGGAGTCCCTTATATGG - Intergenic
965099017 3:164273229-164273251 CCAACACTGAGTCCCTAGTATGG + Intergenic
966481860 3:180418398-180418420 TAAATAATGGCTCCCTGATAAGG + Intergenic
966896551 3:184449299-184449321 CCAACACTGAGTCTATGATATGG - Intronic
969573983 4:8025745-8025767 CCAACTGTGAGTCCCTGAGAGGG - Intronic
971460367 4:26889615-26889637 CCAATAATGAGTCCCTGATATGG - Intronic
972882842 4:43447225-43447247 CCAACACTGAGCCCTTGATATGG - Intergenic
974638130 4:64591474-64591496 CCAATAGTGAGCCTCTGATATGG - Intergenic
975942164 4:79660646-79660668 CCCATAAAGAGTCCCTGCTAGGG + Intergenic
976301213 4:83517184-83517206 CCAGCACTGAGCCCCTGATATGG - Intronic
977089355 4:92651283-92651305 CCCACACTGAGTCCCTGATGTGG - Intronic
977833094 4:101616892-101616914 CCAACACTGAGCCCGTGATATGG - Intronic
978225157 4:106323745-106323767 ACAATAATGAGTATCTGATTAGG + Intronic
978485793 4:109252280-109252302 CCAGCACTTAGTCCCTGATATGG - Intronic
978665384 4:111175705-111175727 CAAATACTGAGTTCCTGATATGG + Intergenic
978986207 4:115015866-115015888 CCAACATTGATTTCCTGATATGG + Intronic
979767139 4:124475543-124475565 CCAATACTGAGTCCTCAATATGG + Intergenic
980691658 4:136303205-136303227 CCAACACTAAGTTCCTGATATGG - Intergenic
981478030 4:145208124-145208146 CCAACACTGAGTCACTGATAGGG - Intergenic
981873669 4:149516145-149516167 CCAACACTGAGTCCTCGATATGG + Intergenic
981979252 4:150771673-150771695 CCAACAGTAAGTCCCTGATAAGG - Intronic
982575483 4:157103831-157103853 CCAATAATGAATATCTGAAAAGG - Intronic
982597642 4:157406106-157406128 CCATCACTGAGTCCTTGATATGG - Intergenic
982623203 4:157731940-157731962 CCAACATTGAGCCCTTGATACGG - Intergenic
982835682 4:160117593-160117615 CCAACACTGAGCCCTTGATATGG + Intergenic
983582816 4:169325761-169325783 CCAACACTGAGCCCTTGATATGG + Intergenic
985107681 4:186514944-186514966 CAGATACTGAGACCCTGATATGG + Intronic
986261500 5:6151576-6151598 CCAACACTGAGCCCTTGATATGG - Intergenic
988169074 5:27631890-27631912 CCAACACTGAGCCCTTGATATGG - Intergenic
990171981 5:53061620-53061642 CCTATGATGAATCCCAGATATGG + Intronic
990289075 5:54330403-54330425 CCAACAGTGAACCCCTGATATGG - Intergenic
991234279 5:64376111-64376133 TCAACAACAAGTCCCTGATATGG + Intergenic
991330608 5:65488734-65488756 CCAACACTGAGCCCTTGATATGG - Intergenic
992331807 5:75724697-75724719 TCAATTATGAGTCCATAATAGGG + Intergenic
993197678 5:84769798-84769820 CCAACACTGAGTCCCAAATATGG - Intergenic
993440115 5:87946236-87946258 TCAATGATGAGTGCCTGCTATGG + Intergenic
995280859 5:110334013-110334035 CCAGTGCTGAGTCACTGATAGGG - Intronic
995324391 5:110873965-110873987 CCAACAATGAGCTCTTGATATGG + Intergenic
997527083 5:134560355-134560377 CCAATAATGTGTCCCAGGAAGGG + Intronic
998290197 5:140907605-140907627 CCAACACTGAGCCCTTGATATGG - Intronic
1000422735 5:161056911-161056933 CCAACACTGAGCCCCTGATATGG - Intergenic
1003648588 6:7937466-7937488 ACAATAATGAGGACCTCATAAGG + Intronic
1004032097 6:11880483-11880505 CCAATAATTACTACCTGATATGG - Intergenic
1004298711 6:14437607-14437629 CCAGTGTTGAGCCCCTGATATGG + Intergenic
1004945176 6:20604336-20604358 CCAACATTGAGTCCCTGATATGG + Intronic
1007282048 6:40720122-40720144 CCACTGCTGAGTCCCTGAAAGGG + Intergenic
1009642014 6:66350158-66350180 CCAACACTGAGTCCTTGATCAGG + Intergenic
1010016032 6:71105533-71105555 CCAATATTGAGCCCCCAATATGG - Intergenic
1010323702 6:74541439-74541461 CCAACACTGAGCCCTTGATATGG + Intergenic
1010818762 6:80389357-80389379 CCAACACTGAGCCCTTGATATGG + Intergenic
1010938113 6:81885475-81885497 CCAACACTGAGCCCTTGATATGG - Intergenic
1011039220 6:83012352-83012374 CCAACACTGAGCCCTTGATATGG - Intronic
1014417130 6:121196354-121196376 CCAACACTGAGTCCTTGATATGG + Intronic
1014534056 6:122595656-122595678 CCAATACTGAGCCCTCGATATGG - Intronic
1014538715 6:122648814-122648836 CCAACACTGAGTCCCCAATATGG - Intronic
1014895773 6:126897522-126897544 CCAACACTGAACCCCTGATAAGG + Intergenic
1015937671 6:138419261-138419283 CCAATGCTGAGACCCTGATGAGG + Exonic
1018534900 6:164809557-164809579 CCAAGAGTGAGCCCTTGATATGG - Intergenic
1019941301 7:4293696-4293718 CCAAGAAGTAGTCCATGATATGG - Intergenic
1026046356 7:66908164-66908186 CCAACACTGAGCCCTTGATATGG - Intergenic
1026567250 7:71499752-71499774 CCAACACTGACTCACTGATATGG + Intronic
1026653757 7:72238490-72238512 GGAATAATGAGTGTCTGATATGG + Intronic
1028883861 7:95910177-95910199 TCAATATTGAGTCCCTCCTAAGG + Intronic
1030453528 7:109744088-109744110 ACAATACTGAGTCCTTGATATGG - Intergenic
1031420122 7:121541825-121541847 CCACAAATGAGTCCATGATATGG + Intergenic
1032646705 7:133833225-133833247 TGAATAATCAGTCCCTGAGAAGG + Intronic
1033247794 7:139732847-139732869 AAAATAGTGAGTCCCTGATATGG + Intronic
1033315600 7:140294728-140294750 CCCATACTGAGGCCCTAATATGG - Intronic
1033392597 7:140941998-140942020 CCAATGTTGAGCCCCTGATAGGG + Intergenic
1034357135 7:150460013-150460035 CCAATACCAAGTCCCTGATATGG - Intronic
1037675591 8:21048230-21048252 CCAACAATGAGTCCTTGATATGG - Intergenic
1038454318 8:27662691-27662713 CCAACACTGAGTCTCTGACATGG - Intronic
1038875073 8:31539631-31539653 CCTATAATTAGTAACTGATATGG + Intergenic
1042342549 8:67695334-67695356 CCAACACTGAGTCCCCAATATGG + Intronic
1044150928 8:88774017-88774039 CCAACACTGAGCCCTTGATATGG + Intergenic
1044283357 8:90382072-90382094 CCATAAATGGGTCCATGATATGG + Intergenic
1044535378 8:93351672-93351694 CCAACACTGAGTCCCTGATATGG + Intergenic
1046063877 8:109174286-109174308 TCAATAGTAAGTCACTGATAAGG - Intergenic
1047453753 8:124990256-124990278 CCAACATTGAGCTCCTGATATGG + Intergenic
1048511398 8:135065616-135065638 CTGATGCTGAGTCCCTGATATGG - Intergenic
1051564955 9:18486777-18486799 ACAAAAATGACTCCCTGTTATGG - Intronic
1052284836 9:26773185-26773207 CCAAGTGTGAGTGCCTGATAAGG + Intergenic
1052895377 9:33742713-33742735 GCAACATTGAGTCCCTGATATGG - Intergenic
1053710230 9:40799816-40799838 TCAATAATGAGACTCTTATATGG + Intergenic
1054420135 9:64920611-64920633 TCAATAATGAGACTCTTATATGG + Intergenic
1056056776 9:82832904-82832926 CCAATAATGACTCCCGCAAATGG + Intergenic
1056241019 9:84646837-84646859 CCAACCATGAGCCCCTGATATGG - Intergenic
1057242529 9:93423930-93423952 TCAATCATGGGTCCCTGAAATGG + Intergenic
1060178918 9:121518245-121518267 CCAACACTGAGTCCCTGCAATGG + Intergenic
1062104474 9:134745980-134746002 CCAATGATGAGTCCTTGTAAGGG - Intronic
1185851381 X:3491953-3491975 CCACTAATGAATCCCTAATTAGG - Intergenic
1186469632 X:9811189-9811211 CCAACACTGAGCCCTTGATATGG - Intronic
1186536794 X:10358395-10358417 CCAATATTATGTCACTGATAAGG + Intergenic
1188065554 X:25655407-25655429 CCAATACTGAGTACATGATTCGG + Intergenic
1190767087 X:53484277-53484299 CCAAAATTGAGTCCCTGATATGG - Intergenic
1191009194 X:55743389-55743411 CCAACACTGAGTCCCTGATATGG - Intronic
1191588227 X:62851956-62851978 CCAACACTGAGTCCCCAATATGG + Intergenic
1193004898 X:76605430-76605452 ACAATTTTGAGTCCATGATAAGG - Intergenic
1193053622 X:77126713-77126735 CCAATACTGAGCCTTTGATATGG + Intergenic
1193436111 X:81476914-81476936 CCAATTATGAGTTCCTGTTTGGG + Intergenic
1194584244 X:95714005-95714027 CCAACACTGAGCCCTTGATATGG + Intergenic
1195872302 X:109499137-109499159 CCAATGTTGAGCTCCTGATATGG - Intergenic
1197044547 X:121979254-121979276 CCAACACTGAGCCCTTGATATGG + Intergenic
1197504645 X:127286690-127286712 CCAACACTGAGTCTCTGATATGG - Intergenic
1198136910 X:133762220-133762242 CTGCTAATGAGTCCCTGACAAGG - Intronic
1198347565 X:135773778-135773800 CCAACACTGAGTCCCCAATATGG + Intergenic
1198349470 X:135791039-135791061 CCAACACTGAGTCCCCAATATGG + Intergenic
1198351375 X:135808312-135808334 CCAACACTGAGTCCCCAATATGG + Intergenic
1198353284 X:135825578-135825600 CCAACACTGAGTCCCCAATATGG + Intergenic
1198355191 X:135842832-135842854 CCAACACTGAGTCCCCAATATGG + Intergenic
1198357101 X:135860115-135860137 CCAACACTGAGTCCCCAATATGG + Intergenic
1198359015 X:135877394-135877416 CCAACACTGAGTCCCCAATATGG + Intergenic
1198782906 X:140256865-140256887 CCAATACTGAGCTCTTGATATGG - Intergenic
1199021366 X:142882038-142882060 CCTGCACTGAGTCCCTGATATGG + Intergenic
1199116445 X:143998316-143998338 CCAATACTGACTCCTCGATATGG - Intergenic
1199144330 X:144348031-144348053 CCAACACTGAGCCCTTGATATGG - Intergenic
1200811413 Y:7489217-7489239 CCACTAATGAATCCCTAATTAGG + Intergenic