ID: 971460373

View in Genome Browser
Species Human (GRCh38)
Location 4:26889660-26889682
Sequence CCTCATTAGCACCTGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971460367_971460373 22 Left 971460367 4:26889615-26889637 CCATATCAGGGACTCATTATTGG 0: 1
1: 1
2: 10
3: 46
4: 226
Right 971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971460373 Original CRISPR CCTCATTAGCACCTGTAGCC AGG Intronic
900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG + Exonic
900745247 1:4356439-4356461 TCTCATTTGCCCCTGCAGCCCGG + Intergenic
904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG + Exonic
904644951 1:31958646-31958668 CCTCATCATGACCTGAAGCCTGG + Intergenic
905225539 1:36476476-36476498 CTTCAATAGCTCCTGTGGCCTGG + Intronic
916190023 1:162169386-162169408 CCTCATTAGCACCCCCAGCAGGG - Intronic
917789445 1:178490172-178490194 CATCATCGGCACCTGCAGCCAGG + Intergenic
918013672 1:180611481-180611503 CCTCTTTAGCAGCTGAAGGCAGG - Intergenic
920547278 1:206828957-206828979 CCTCATGCACACCTGTAGTCAGG - Intronic
1065382216 10:25101936-25101958 GCTAATTAGCATCTGTAGGCAGG + Intergenic
1067519068 10:46981400-46981422 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1067643177 10:48070434-48070456 ACTCAGTAGCAGCTGTAGCCAGG + Intergenic
1068403779 10:56563985-56564007 GCTCATTTGATCCTGTAGCCTGG - Intergenic
1069787702 10:70999227-70999249 CCTCATTCGCACCTGGAGTAAGG - Intergenic
1071168100 10:82830684-82830706 CCTCATTAGAAGCTGTATTCTGG + Intronic
1074435026 10:113426638-113426660 GCTAATTATCACCTGTAGCTTGG - Intergenic
1077799795 11:5526262-5526284 CTTCATTAGCTTCTCTAGCCTGG + Intronic
1079022665 11:16922736-16922758 CCTCAGTAGCAGCTGTGGCAGGG - Intronic
1080885578 11:36364684-36364706 CATCCTTAGCAAGTGTAGCCAGG + Intronic
1084427759 11:69094854-69094876 CCCCAGCAGCACCTGTTGCCAGG + Intergenic
1088542464 11:110927442-110927464 CCTCATAAGGAACTGGAGCCAGG - Intergenic
1092797398 12:12126210-12126232 CCTTATTAGCACATGAAGTCAGG + Intronic
1095811255 12:46374546-46374568 CCTCCTTAGCACCTCTAACTGGG - Intergenic
1096684286 12:53277592-53277614 CCTCACCAGCATCTGCAGCCAGG - Exonic
1097461847 12:59872045-59872067 CCTCATTAGATCCTGGTGCCAGG + Intergenic
1107338760 13:39383804-39383826 CCACATTCACACCTGCAGCCAGG + Intronic
1108006067 13:45947871-45947893 CCTCCTTAGCACATGCAGGCAGG - Intergenic
1112701007 13:102008011-102008033 ATTCATTCTCACCTGTAGCCTGG - Intronic
1114775986 14:25482048-25482070 CCTCATAAACAACTGAAGCCAGG - Intergenic
1122013028 14:98769389-98769411 CCTCCTTAGCATCTATGGCCAGG - Intergenic
1128091999 15:64925589-64925611 CTTCATTAGCAGCTGTATCAAGG + Intronic
1129829956 15:78662115-78662137 CTTCATTAACACCTGTGCCCTGG - Intronic
1132118670 15:99158071-99158093 CCTCATCAGCACCTGTAATGTGG - Intronic
1134570734 16:15288737-15288759 CCTCATTAGCACATGAATGCTGG - Intergenic
1134731647 16:16467337-16467359 CCTCATTAGCACATGAATGCTGG + Intergenic
1134935805 16:18244666-18244688 CCTCATTAGCACATGAATGCTGG - Intergenic
1137522556 16:49207270-49207292 CCTCATTAGATTCTGTAGACAGG - Intergenic
1141054377 16:80803303-80803325 ACTCATTAGGACCTGGAGCCAGG + Intronic
1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG + Intergenic
1144565983 17:16359738-16359760 CCTCAGCAGCCCCTGTAGCTGGG + Intergenic
1146489785 17:33272139-33272161 GCTCATTAGCTCATGTAGTCAGG - Intronic
1148617041 17:49008688-49008710 CATGGTTAGCAACTGTAGCCTGG + Intronic
1151979344 17:77499397-77499419 CATCAGCAGCACCTGCAGCCCGG - Exonic
1152760718 17:82105793-82105815 CCTCACTGGCACATGGAGCCTGG + Intronic
1153369217 18:4295004-4295026 CCTCATCTGCTCCTGGAGCCTGG + Intronic
1160463428 18:79056448-79056470 CCTCAGGAGGACCTGTAGCTGGG + Intergenic
1162790090 19:13058203-13058225 CCTGCTTAGCCCCTGGAGCCTGG - Intronic
1168701045 19:58439789-58439811 CCCCATTAGAACCTGTGGGCTGG + Exonic
926795746 2:16617572-16617594 CCTCATTAAGGCCTGCAGCCAGG + Intronic
929028924 2:37632861-37632883 CCTCATAAGGACCTTTAGTCAGG + Intergenic
929636052 2:43521645-43521667 CCTGAATAGCAGCTATAGCCTGG - Intronic
932975797 2:76598101-76598123 ACTCAGCAGTACCTGTAGCCAGG - Intergenic
933409781 2:81910428-81910450 CCTCATCTGCTCCTGGAGCCTGG + Intergenic
937983099 2:127626405-127626427 CCTCATTAGCATCTGTAGGGCGG - Intronic
939227427 2:139381814-139381836 ACTCAATAGCACCTGTAGCCAGG + Intergenic
943326560 2:186505820-186505842 CCTCATCACCACCTGTTCCCTGG - Exonic
943757660 2:191573695-191573717 CCTCATTAGCCCCAGGAGACTGG + Intergenic
946481282 2:220059220-220059242 CCTCCTCAGCACCTGTAGCTAGG + Intergenic
948954176 2:241273778-241273800 CCTCAACAGCACCCGTGGCCTGG - Intronic
1170525010 20:17228142-17228164 CCTCTCCAGCTCCTGTAGCCGGG - Intronic
1170867039 20:20167183-20167205 CCTCATTAGAAACAGTATCCAGG - Intronic
1172737523 20:37138837-37138859 CATCATCAGCACCAGTAGGCTGG + Intronic
1179097236 21:38326833-38326855 CCTCATAAGCAACTGTGGACAGG + Intergenic
1179983181 21:44907030-44907052 CCTCATGAGCAGCTGTGGCCGGG + Exonic
1184130683 22:42514880-42514902 TCTCCTTAGCACCTGTGCCCCGG - Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184420695 22:44381331-44381353 CCTCCTCAGCTCCTGTTGCCAGG - Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
952808637 3:37381476-37381498 CCTCATTAACACCTGGAGTTGGG + Intergenic
953204815 3:40816142-40816164 CCTCATTGGCACCCATAGGCAGG + Intergenic
962047980 3:131781060-131781082 CCTCATTAAAACATTTAGCCAGG - Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
979284725 4:118909526-118909548 CCACATTAGCACCTGGACTCTGG - Intronic
981031024 4:140126074-140126096 CCTCTTTAACACCTGTACCTTGG - Intronic
984418141 4:179486776-179486798 ACTCAGTAGCAGCTTTAGCCAGG + Intergenic
985672123 5:1212502-1212524 CCTCTGGAGCACCTGCAGCCTGG - Intronic
987251726 5:16107727-16107749 CCTCATCTGCTCCTGGAGCCTGG - Intronic
991294723 5:65068588-65068610 CCTCATTGACAGCTGTAGGCAGG + Intergenic
992670997 5:79061105-79061127 TCACATCAGCACCTGTAGCTGGG - Intronic
996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG + Intergenic
997658283 5:135571321-135571343 CCACAGTGGCCCCTGTAGCCGGG - Exonic
1001794515 5:174490949-174490971 CCTCATTCCCACCTGTTGCCTGG - Intergenic
1005375483 6:25178078-25178100 GCTCATCAGCACATGAAGCCTGG + Intergenic
1007930841 6:45689245-45689267 CCTCATCCCCACCAGTAGCCAGG + Intergenic
1008370567 6:50725681-50725703 CATCATTACCATCTGTAGTCTGG + Intronic
1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG + Intronic
1019506000 7:1391725-1391747 CCTCATGAGAGCCTGGAGCCAGG - Intergenic
1020036273 7:4964999-4965021 CATCAACAGCACCTGTAGGCAGG + Intergenic
1023320679 7:38994438-38994460 CCTCATTTGCACCTTTGTCCTGG - Intronic
1024006634 7:45229142-45229164 TCTCCTTGGCACCTGCAGCCAGG + Intergenic
1029866626 7:103638308-103638330 CCTCATTAGCATCTCTAACAGGG + Intronic
1035599887 8:891167-891189 CCTCAATCACACCTGTGGCCTGG - Intergenic
1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG + Intronic
1037953785 8:23037293-23037315 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1046710542 8:117506400-117506422 CCACAGTTGCACCTCTAGCCTGG + Intergenic
1047104450 8:121718092-121718114 ACTCATTAGCAGCTGTGGTCTGG + Intergenic
1049966993 9:788876-788898 CCTCATTAGACCCTGTGCCCTGG - Intergenic
1051800259 9:20924809-20924831 TTTCATTAGTACCTGTTGCCTGG - Intronic
1056617440 9:88180520-88180542 CCTCATTGCCCCCTGGAGCCAGG - Intergenic
1059332719 9:113546120-113546142 CCTGCTTTGCACCTGGAGCCCGG + Intronic
1059440402 9:114303533-114303555 CATGAAAAGCACCTGTAGCCCGG - Intronic
1190527776 X:51345420-51345442 ACTCAGCAGCAGCTGTAGCCAGG + Intergenic
1190944005 X:55073088-55073110 CCCCAGTAGCACCTGGAACCCGG - Intergenic
1192509528 X:71713674-71713696 CCTCCTTAGCTTCAGTAGCCAGG - Intergenic
1192517169 X:71767879-71767901 CCTCCTTAGCTTCAGTAGCCAGG + Intergenic
1200333278 X:155320151-155320173 TCTCTTTAGCACCAGTAGGCAGG - Intronic